Original Research Open Access Logo

Cytotoxicity and antiproliferative activity of Arctium lappa extract on an in vitro model of human colorectal cancer

Amal I. Hassan 1, * ORCID logo
Ibrahim I. Bondouk 2
Mohamad Taha Abdelrahman 1
Hosam M. Saleh 1
  1. Department of Radioisotopes, Nuclear Research Centre, Egyptian Atomic Energy Authority, Egypt
  2. Physics Department, Faculty of Science, University of Tanta, Tanta, Egypt
Correspondence to: Amal I. Hassan, Department of Radioisotopes, Nuclear Research Centre, Egyptian Atomic Energy Authority, Egypt. ORCID: https://orcid.org/0000-0002-3760-1235. Email: virtualaml@gmail.com.
Volume & Issue: Vol. 12 No. 2 (2025) | Page No.: 7153-7167 | DOI: 10.15419/bmrat.v12i2.960
Published: 2025-02-28

Online metrics


Statistics from the website

  • Abstract Views: 2887
  • Galley Views: 1374

Statistics from Dimensions

This article is published with open access by BioMedPress. This article is distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0) which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. 

Abstract

Background : Natural remedies are an excellent source for screening innovative and safe anti-cancer medicines. This study is intended to explore the potential toxicity of burdock seed extract, Arctium lappa (A. lappa), as well as its anti-regenerative and anti-proliferative effects on tumor cells in vitro.

Methods: The antiproliferative effect of A. lappa ethanol extract (EtOH) was evaluated on human colorectal carcinoma (H-COLO-205) cells and normal skin fibroblast (HSF) cell lines using the SRB assay. Matrix metalloproteinases (MMP-2 and MMP-9) and apoptotic gene expressions (e.g., BAX, BCL-2, P53) were analyzed using Western blot and qRT-PCR, respectively.

Results: A. lappa inhibited H-COLO-205 cell growth with an IC₅₀ of 11.80 µg/mL while sparing normal HSF cells (IC₅₀ = 1485 µg/mL). The extract significantly increased pro-apoptotic gene expression, with upregulation of caspase-3 (4.07-fold), caspase-9 (3.66-fold), P53 (2.69-fold), and BAX (22.44-fold), and downregulated the anti-apoptotic gene BCL-2 by 13.33-fold. Migration assays showed that A. lappa reduced MMP-2 and MMP-9 protein levels by 1.36-fold and 1.34-fold, respectively. The extract also downregulated NF-κB expression and significantly decreased the levels of inflammatory cytokines IL-6, IL-1β, and TNF-α. Furthermore, A. lappa enhanced DNA fragmentation, with a 4.36% increase in comet tail migration and an 18.88 tail moment at a 100 µg/mL concentration. Molecular docking revealed that arctigenin, a major compound in A. lappa, forms stabilizing hydrogen bonds with TGF-βR1, inhibiting its kinase function and associated cancer pathways.

Conclusion: These results indicate that A. lappa may serve as a promising plant-derived anticancer medication for colon cancer.

Introduction

Colorectal cancer poses a significant global health concern, with more than 1.5 million new cases reported worldwide in 2018. This number is projected to rise by 60% by the year 20301. The effectiveness of chemotherapy in treating cancer is limited due to issues such as toxicity and tumor resistance. However, A. lappa seeds offer a promising solution as they contain essential oils, lignans, chlorogenic acid, and vitamins, including the potent antitumor compound arctigenin2, 3. Recent research demonstrates that several plant extracts, such as alkaloids, flavonoids, and polyphenols, which have a high molecular weight, could prove effective in the therapy of human multiple myeloma (HMM)4 and bone marrow (HBM8-k562) cells5. These compounds also showed antitumor activity against aggressive malignancies of the liver (Huh-7), oral cavity (HTB-43), and bladder (ECV304)6.

In this study, we aim to find out the effects of A. lappa extract on human colorectal cancer cells, specifically the cell line Colo-205. This research specifically aims to determine (1) the cytotoxicity of A. lappa extract on Colo-205 cells, (2) its effect on cell proliferation and migration, and (3) to explore the molecular mechanisms behind its antiproliferative and pro-apoptotic effects using in vitro assays and molecular docking techniques.

Methods

Chemicals and Reagents

The chemicals and reagents used in this research were of high purity. Ethanol (≥ 99.8%), methanol (≥ 99.9%), and acetonitrile (HPLC grade, ≥ 99.9%) were from Sigma-Aldrich, St. Louis, MO, USA. Potassium persulfate, trichloroacetic acid (TCA), aluminum chloride, sodium carbonate, and Folin-Ciocalteu reagent were from Merck, Darmstadt, Germany. Trypan blue dye (0.4%) and phosphate-buffered saline (PBS) were from Gibco (Thermo Fisher Scientific, USA). All solvents used in HPLC analysis were ≥ 99.8% pure and from Fisher Scientific (Waltham, MA, USA), including ethyl acetate and ethyl ether. The HPLC standards, which include cinnamic acid, benzoic acid derivatives, and gallic acid, came from Sigma-Aldrich with a purity of ≥ 98%.

The chemicals used for preparing proteins and for Western blotting, such as acrylamide, bis-acrylamide, SDS, TEMED, ammonium persulfate, and Tris-HCl, were purchased from Bio-Rad, Hercules, CA, USA. ELISA kits for cytokine studies were from R&D Systems, Minneapolis, MN, USA. All chemicals used for the comet assay, including ethidium bromide, Triton X-100, and sodium lauroyl sarcosinate, were from Sigma-Aldrich.

Plant Seeds Collection

In April 2019, A. lappa seedlings were obtained from Tanta University's medicinal plant garden in Tanta, Egypt. Ethanol extraction was performed on powdered A. lappa seeds, yielding dark brown residues.

Phenolic Acids Profile in A. Lappa by HPLC

A 1 g sample was transferred into a conical flask equipped with a quick-fit system, followed by the addition of 20 mL of 2 M NaOH. The flask was flushed with nitrogen gas, sealed, and shaken for 4 hours at room temperature. The pH was adjusted to 2 using 6 M HCl. After centrifugation at 5000 rpm for 10 minutes, the supernatant was removed. Phenolic compounds were extracted in two stages using 50 mL of a 1:1 solution of ethyl acetate and ethyl ether. The organic layer was isolated and evaporated at 45°C, and the residue was dissolved in 2 mL of methanol7. An Agilent 1260 series HPLC system was utilized for analysis, employing a Zorbax Eclipse Plus C8 column. The mobile phase consisted of acetonitrile (solvent A) and a 2% acetic acid solution in water (v/v) (solvent B). The flow rate was maintained at 0.8 mL/min over a 70-minute run. The gradient program was as follows: 100% solvent B reduced to 85% over 30 minutes, then to 50% over the next 20 minutes, followed by a drop to 0% in 5 minutes, and finally returned to 100% B in the last 5 minutes. A 50 µL injection volume was used, and peaks for cinnamic acid and benzoic acid derivatives were monitored concurrently at 280 nm and 320 nm. Samples were filtered through a 0.45 µm syringe filter before injection. Peaks were identified by matching retention times and UV spectra with standards.

Total Flavonoid Content (TFC) in A. Lappa Ethanolic Extract

To assess the total flavonoid content, the aluminum chloride assay was utilized8. Samples (500 µL in tubes) at a 1 mg/mL concentration were prepared, followed by the addition of 0.1 mL of 1 M potassium acetate solution, 0.1 mL of 10% aluminum chloride solution, 1.5 mL of methanol, and 2.8 mL of distilled water. After a 30-minute incubation at room temperature, absorbance was measured at 415 nm using a spectrophotometer.

Total Phenol Content in A. Lappa Ethanolic Extract

The Folin-Ciocalteu reagent was employed to quantify the phenol content in the samples, following a previously established method9. In our procedure, 1 mL of the extract was mixed with 5 mL of tenfold-diluted Folin–Ciocalteu reagent and 4 mL of sodium carbonate solution (75 g/L). After incubating the mixture for 30 minutes at room temperature, the absorbance was measured at 765 nm using a spectrophotometer. Gallic acid was used as the standard for calibration, and the total phenolic content was expressed in milligrams of gallic acid equivalents (GAE) per gram of extract.

Free Radical Scavenging

The DPPH assay was conducted to measure the antioxidant capacity of A. lappa extract10. Samples (at 6–200 µg/mL) were mixed with 100 µL of 1,1-diphenyl-2-picrylhydrazyl (DPPH) to achieve a final DPPH concentration of 100 µM. Absolute methanol served as the negative control. After incubation at 37°C, absorbance was measured at 512 nm using a UV-Vis Spectrophotometer 2401PC (Shimadzu, Japan). Ascorbic acid (Vitamin C) was used as a standard.

ABTS˙⁺ [2, 2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] Radical Scavenging Activity

The ABTS test was used to determine the radical scavenging activity of A. lappa extract11. This method involves the generation of the ABTS radical cation (ABTS˙⁺) by the oxidation of ABTS with an oxidizing agent, typically potassium persulfate. The resulting ABTS˙⁺ is a stable, blue-green chromophore that absorbs light at a wavelength of approximately 734 nm.

In this study, the ABTS assay was employed to determine the radical scavenging capacity of Arctium lappa extract. The extract was introduced to the ABTS˙⁺ solution, and its antioxidant compounds reduced the radical cation, leading to a decrease in absorbance at 734 nm. This reduction is directly proportional to the antioxidant activity of the sample. The results were likely quantified as a percentage of radical scavenging activity or compared to a standard antioxidant, such as Trolox, to calculate the Trolox Equivalent Antioxidant Capacity (TEAC).

The method is valued for its sensitivity and ability to measure the antioxidant capacity of both hydrophilic and lipophilic compounds, making it suitable for diverse biological extracts like A. lappa.

Reducing Power (RP) of Arctium lappa Ethanol Extract

The RP test was conducted to determine the reducing power of A. lappa extract12. This method works on the principle that antioxidants can reduce ferric ions (Fe³⁺) to ferrous ions (Fe²⁺), which then form a colored complex with ferricyanide. The intensity of this color is directly proportional to the sample's reducing power and can be quantified spectrophotometrically.

To assess the reducing power of the ethanol (EtOH) extract of Arctium lappa, the assay was conducted using standard reagents and procedures. Phosphate buffer (0.2 M, pH 6.6) was prepared to maintain optimal pH conditions for the reaction, and potassium ferricyanide [K₃Fe(CN)₆] was used as the electron acceptor. Trichloroacetic acid (TCA, 10%) was employed to terminate the reaction, while ferric chloride (FeCl₃, 0.1%) was added to detect the presence of ferrous ions. Varying concentrations of the A. lappa ethanol extract (e.g., 20–100 µg/mL) were mixed with 2.5 mL of phosphate buffer and 2.5 mL of potassium ferricyanide solution. These mixtures were incubated at 50°C for 20 minutes to allow for the reduction of ferricyanide to ferrocyanide.

After the incubation, the reaction was halted by adding 2.5 mL of TCA, and the mixtures were centrifuged at 3000 rpm for 10 minutes to separate the supernatant. A 2.5 mL aliquot of the supernatant was combined with 2.5 mL of distilled water and 0.5 mL of 0.1% ferric chloride solution. This mixture was allowed to stand for 10 minutes to develop the characteristic color of the reaction. The absorbance of the resulting solution was measured at 700 nm using a UV-Vis spectrophotometer. A higher absorbance indicated greater reducing power, which reflects the antioxidant capacity of the A. lappa extract.

The assay included ascorbic acid as a positive control for comparison and a blank sample, containing all reagents except the extract, as a negative control. The reducing power of the A. lappa ethanol extract was expressed as absorbance values at 700 nm. Results were plotted as a function of extract concentration, with a higher slope indicating stronger reducing activity. Furthermore, the reducing power of the extract was compared to ascorbic acid to evaluate its relative antioxidant capacity.

The results of the RP assay demonstrated that the ethanol extract of Arctium lappa possesses notable electron-donating properties, indicative of its potential as a natural antioxidant source. These findings suggest that A. lappa extract has promising therapeutic applications due to its antioxidant properties.

Cell Culture

This study utilized COLO-205 (human colorectal cancer) and normal skin fibroblast cell lines (HSF), both obtained from Nawah Scientific Inc. (Egypt). All experiments were conducted in accordance with institutional biosafety guidelines in a certified laboratory facility. As this research employed only commercially available cell lines and plant extracts, no specific ethical approval for human or animal subjects was required.

The cells were cultured within RPMI medium with streptomycin, penicillin, and fetal bovine serum at 37°C within a CO-rich atmosphere. All cell testing was conducted in a laminar flow hood, with only sterilized instruments coming into direct contact with the cells. After the cells had achieved 80-90% confluence for 2 days, the culture was renewed. For splitting, the media was aspirated, and the cells underwent three washes utilizing phosphate-buffered saline with a pH of 7.4. PBS was removed from the flasks, and 0.025% trypsin-EDTA was added. Flasks were incubated for 3-5 minutes in the incubator before cells were released. Cells were diluted to the desired concentration and cultured in fresh flasks.

Cell Count

Trypan blue staining and hemocytometer counting were performed to determine cell viability and density13. This method is widely used to assess the health of cells in culture by distinguishing live cells from dead cells based on membrane integrity. Trypan blue selectively stains dead cells with compromised membranes, while viable cells remain unstained.

The process began with the preparation of materials and reagents. Trypan blue dye (0.4%) was used for staining, while phosphate-buffered saline (PBS) was employed for washing the cells before counting. A hemocytometer (Neubauer chamber) and a light microscope were used for manual cell counting. Cells were harvested from the culture flask using appropriate methods. Adherent cells were detached enzymatically using trypsin-EDTA while suspension cells were directly collected. The cell suspension was centrifuged at 300 g for 5 minutes, and the supernatant was discarded. The pellet was resuspended in 1 mL of fresh culture medium or PBS.

For staining, 10 µL of the cell suspension was mixed with 10 µL of Trypan blue dye to create a 1:1 dilution. The mixture was gently pipetted to ensure even distribution of the dye and incubated at room temperature for 1–2 minutes. A cleaned hemocytometer was prepared by placing a coverslip over the counting grid, and 10 µL of the stained cell suspension was carefully loaded into one of the chambers, ensuring no bubbles or overfilling occurred.

The hemocytometer was placed under a light microscope at 10× magnification. The total number of live and dead cells was recorded. Cell concentration was calculated using the formula:

Cell concentration (cells/mL) = (Average number of cells per quadrant × Dilution factor × 10⁴) / Volume of quadrant (0.1 mm³)

The percentage of cell viability was determined by dividing the number of viable cells by the total number of cells and multiplying by 100. The results included the total number of live, dead, and total cells per mL, along with the viability percentage, providing essential data on the health of the cell culture. These metrics guided experimental planning, such as determining the seeding density for further applications.

Cytotoxicity Assay

The sulfate-reducing bacteria (SRB) test was conducted to assess cell survival following exposure to A. lappa extract14. In 96-well plates, 100 µL of a cell suspension (5 × 10³ cells) was added to the complete medium and incubated for 24 hours. A second aliquot of 100 µL of media containing A. lappa methanolic seed extract was applied to the cells. Cisplatin (CP) was used as a reference drug at varying concentrations (0.01, 0.1, 1, 10, and 100 µg/mL). After 72 hours of treatment, the cells were harvested by replacing the culture media with 150 µL of 10% trichloroacetic acid (TCA) and incubating at 4 °C for 1 hour. Following TCA removal, the cells were washed five times with distilled water.

Next, 70 µL of 0.4% (w/v) SRB solution was added, and the cells were incubated in darkness at room temperature for 10 minutes. The plates were washed three times with 1% acetic acid and allowed to air dry overnight. The bound SRB stain was dissolved in 150 µL of TRIS buffer (10 mM), and absorbance was measured at 540 nm using a BMG LABTECH® FLUOstar Omega microplate reader (Ortenberg, Germany).

Western Blotting of MMP-2 & MMP-9

Western blotting was conducted to analyze the expression levels of MMP-2 and MMP-9. Protein concentrations were determined using the Bradford method15. Standard Western blotting procedures were followed. Proteins (30 µg per lane) were separated on a 10% SDS-PAGE gel using a non-continuous buffer system. The separating gel contained 10% acrylamide-bisacrylamide (30:0.8 ratio), 0.1% SDS, 0.05% TEMED, 0.05% ammonium persulfate, and 375 mM Tris-HCl (pH 8.8). The stacking gel (4%) was formulated with 0.5 M Tris-HCl (pH 6.8). Electrophoresis was performed at 75 V through the stacking gel and 125 V through the resolving gel for approximately 2 hours. A PageRuler™ Unstained Broad Range Protein Ladder (Thermo Scientific™, Catalog No. 26630) was used as the molecular weight marker.

Following electrophoresis, proteins were transferred to Hybond™ nylon membranes (GE Healthcare) and blocked with 2–5% nonfat dry milk in Tris-buffered saline (TBS, pH 7.4, containing 25 mM Tris, 150 mM NaCl, and 0.1% Tween® 20 [TBST]) for 1 hour at room temperature. The membranes were incubated overnight at 4 °C with primary antibodies against MMP-2 (ab86607, Abcam, 1:1000 dilution, 73 kDa) and MMP-9 (ab228402, Abcam, 1:1000 dilution, 78 kDa).

After three washes with TBST, the membranes were treated with horseradish peroxidase (HRP)-conjugated secondary antibody (0.1–0.5 µg/mL) for 1 hour at room temperature. β-actin was used as a loading control. Enhanced chemiluminescence (ECL) reagents (Amersham Biosciences) were used to detect the immunoreactive bands. The detected bands were quantified using Totallab analysis software (Version 1.0.1), with band intensities normalized to β-actin and expressed as a percentage of the control.

Finally, the protein bands were visualized and quantified using the ChemiDoc XRS imaging system (Bio-Rad Laboratories, USA) after three washes in TBST. Tween is a registered trademark of ICI Americas.

Gene Expression of BCL2, BAX, and P53

Total RNA was extracted from cell homogenates using the RNeasy Purification Kit (Qiagen, Valencia, CA, USA). Briefly, the cell homogenates were prepared by lysing the cells in the lysis buffer of the kit. The buffer contains guanidine isothiocyanate that enhances RNA protection and protein denaturation, yielding a high RNA output in purity and quantity. The homogenized lysate was transferred into a spin column containing a silica-based membrane that securely bound the RNA molecules. Packaged RNA was washed a number of times by using the kit's included washing machine in order to get rid of contaminants like proteins, DNA, and lipids. DNase digestion had been performed on the column during the operation in order to prevent contamination with genomic DNA. Lastly, the purified RNA was eluted from RNase-free water and then pooled into sterile tubes for subsequent analyses. The quality and concentration of RNA extracted were checked by two different methods. First, RNA integrity was checked by gel electrophoresis, and the presence of distinct 28S and 18S rRNA bands confirmed a positive RNA class. RNA concentration and purity were measured spectrophotometrically using a Gene Quant 1300 spectrophotometer (Uppsala, Sweden). The absorbance at 260 nm (A260) was used to quantify RNA concentration, while the A260/A280 ratio provided an estimate of RNA purity, with values between 1.8 and 2.0 indicating minimal protein contamination. These steps ensured that the RNA samples were of sufficient quality and quantity for downstream applications such as cDNA synthesis and gene expression.

cDNA Synthesis

First-strand cDNA was synthesized from 4 μg of total RNA as a template, with an oligo (dT)1200 primer and SuperScript™ II RNase H reverse transcriptase (Life Technologies, Breda, The Netherlands) This method targets a poly-A tail a mature upon mRNA did so, ensuring the selection of cDNA from mRNA transcripts. RNA, primer, dNTPs, first-strand buffer, dithiothreitol (DTT), and reverse transcriptase enzyme, prepared in the absence of RNase, in a reaction mixture with a total volume of 20 μL, to prevent RNA degradation or degradation. Initially, the RNA and primer were modified at 65°C for 5 min and then rapidly chilled on ice to minimize secondary products that could interfere with reverse transcription. The reverse transcription reaction was performed at 42°C for 60 min, allowing the enzyme to synthesize complementary DNA. After the reaction, the enzyme was inactivated by heat treatment at 70°C for 15 min. The resulting cDNA was stored at −20°C for subsequent gene expression studies, such as quantitative PCR (qPCR). This approach resulted in high-quality and specific cDNA synthesis, providing reliable templates for downstream analysis.

Real-time Quantitative Polymerase Chain Reaction (RT-PCR)

RT-PCR amplification was accomplished utilizing 10 µl amplification solutions comprising Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 300 nM primers, and 8 ng of reverse-transcribed ribonucleic acid. An ABI PRISM 7900 HT detection platform was employed to perform the reactions (Applied Biosystems). Data from PCR reactions that were run at 95°C for 10 minutes (1 cycle), 94°C for 15 seconds, and 60°C for 1 minute (40 cycles) were resolved using the ABI Prism sequence detection system software and the PE Biosystems v17 Sequence Detection Software (Foster City, CA) was employed for quantification. We computed the relative gene expression using the comparative threshold cycle technique. Furthermore, the results were standardized to the glyceraldehyde-3-phosphate dehydrogenase enzyme. The primer sequences are listed in Table 1.

Table 1

The oligonucleotide primers sequence of studied genes

Gene

Forward primer

(5' ------ 3')

Reverse primer

(5' ------ 3')

BCL2

AGGAAGTGAACATTTCGGTGAC

GCTCAGTTCCAGGACCAGGC

BAX

GTTGCCCTCTTCTACTTTG

AGCCACCCTGGTCTTG

P53

TAACAGTTCCTGCATGGGCGGC

AGGACAGGCACAAACACGCACC

NF-κB

TCTCCTCGCTGGAAAAAGAA

AATGTGCTGGCTGTGCTTTA

GAPDH

TGCTGGTGCTGAGTATGTCG

TTGAGAGCAATGCCAGCC

IL6, IL1β, and TNF-α

ELISA kits were employed to measure cytokine release from COLO-205 cells. The cells were seeded in six-well plates and allowed to adhere for 24 hours. Following this, the cells were treated with A. lappa extract (100 µg/mL) for 48 hours. The levels of caspase 3, 9, IL-6, IL-1β, and TNF-α in the cell culture supernatants were quantified using ELISA kits (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. A chromogenic substrate was used to develop the color reaction, and the optical density (OD) was measured at 495 nm using a microplate reader.

Comet Assay

The comet assay was conducted to detect DNA damage resulting from treatments16. After flushing the cells with 3 mL of PBS, the cell solution underwent filtration with a 150-µm bolting cloth. Following the combination of 25 µL of cell suspension with 250 µL of melted low-melting-point agarose in a 1:10 ratio, 75 µL of the resulting mixture was applied evenly onto the slides. Once the gel had set for 20 minutes at 4.0°C, the slides were placed within a tank containing a lysis solution (0.1 M EDTA, 2.5 M NaCl, 10.0 mM Tris base, 1% Triton X-100, and 1% sodium lauroyl sarcosinate) and left for 1 hour at 4.0°C in darkness. After applying three washes with neutralization solution (0.4 M Tris, pH 7.5) to the slides, they were placed at room temperature for 30 minutes in a new alkaline buffer (1.0 mM EDTA and 0.3 M NaOH, pH >13) to facilitate DNA unwinding. Electrophoresis was performed at ambient temperature for 30 minutes utilizing a chilled alkaline buffer (1V/cm; 300 mA). The slides were then carefully rinsed three times in a neutralizing buffer for 5 minutes each before being subjected to 70% ethanol for 5 minutes. After allowing the slides to dry at room temperature, 25 µL of ethidium bromide solution (20 µg/ml) was applied for staining, and the slides were then covered.

Molecular Docking

The X-ray crystal structure of the Homo sapiens transforming growth factor receptor (TGF-βRI) was obtained from the protein databank depository via http://www.rcsb.org (PDB id: 3FAA) to be docked with the compound under study (Arctigenin) which was acquired from the PubChem database (PubChem CID: 64981) via https://pubchem.ncbi.nlm.nih.gov. The protein structure was ready for docking upon eliminating water molecules and the co-crystallized inhibitor (2-aminoimidazole). Hydrogen was added, and protein structure was stored into a PDB format employing Biovia Discovery Studio 2021. The arctigenin was docked against TGF-βRI (PDB id: 3FAA) within a cavity space defined by the coordinates (x: 75.1939, y: 28.8968, z: 92.6845). The docking was executed utilizing Autodock Vina with the PyRx 0.8 graphical user interface software.

Statistical Analysis

Data were expressed as the mean ± standard error of the mean (SEM) and analyzed using one-way analysis of variance (ANOVA) to determine statistical significance. For multiple comparisons, Tukey–Kramer’s post hoc test was employed to identify significant differences between groups. A p-value of less than 0.05 (p < 0.05) was considered statistically significant. All statistical analyses were performed using the Statistical Analysis System (SAS) software, version 9.0.

Table 2

Quantification of Polyphenol and Flavonoid Compounds in Arctium lappa Extract by HPLC

Compound

Peak Area

Concentration (µg/mL)

Concentration (µg/g)

Gallic acid

721.37

44.99

899.86

Chlorogenic acid

729.89

78.41

1568.14

Coffeic acid

615.31

38.73

774.56

Syringic acid

30.70

1.65

32.91

Rutin

506.19

63.28

1265.52

Ellagic acid

147.15

14.59

291.88

Vanillin

88.60

2.59

51.89

Naringenin

44.38

3.21

64.30

Rosmarinic acid

69.72

5.77

115.32

Daidzein

46.78

2.31

46.20

Querectin

6.95

0.46

9.20

Cinnamic acid

2.67

0.04

0.76

Kaempferol

9.34

0.52

10.43

Hesperetin

24.77

0.94

18.75

Figure 1

HPLC analysis of phenolic and flavonoid compounds in A. lappa extract. The chromatogram shows the retention times and peak areas of major phenolic and flavonoid compounds in the extract.

Abbreviation: HPLC: High-Performance Liquid Chromatography

Results

Phytochemical Estimation in A. lappa

The phytochemical analysis of Arctium lappa revealed strong antioxidant properties. The ethanol extract exhibited a significant IC₅₀ value of 41.17 ± 1.84 μg/mL for DPPH scavenging activity and an IC₅₀ value of 51.65 ± 1.91 μg/mL for ABTS scavenging activity. Additionally, the extract contained high levels of total flavonoids (118.35 ± 0.62 mg QE/g DW) and total phenolics (124.45 ± 0.88 mg GAE/g DW), indicating a rich antioxidant profile. HPLC analysis identified various polyphenolic and flavonoid compounds in the A. lappa extract. The most abundant compounds were chlorogenic acid (1568.14 µg/g), rutin (1265.52 µg/g), and gallic acid (899.86 µg/g). Significant amounts of caffeic acid (774.56 µg/g) were also detected, along with moderate levels of ellagic acid (291.88 µg/g) and rosmarinic acid (115.32 µg/g). These results highlight that A. lappa is rich in potent antioxidant compounds, particularly chlorogenic acid, rutin, and gallic acid (Table 2 and Figure 1).

Figure 2

Effects of A. lappa extract on the growth of Colo-205. A) Untreated Colo-205 cells (Control). Baseline cell viability of Colo-205 cells with no treatment, serving as the control group (100% viability). B) Colo-205 cells treated with Cisplatin. Dose-dependent inhibition of Colo-205 cell viability following treatment with varying concentrations of cisplatin for 72 hours. C) Colo-205 cells treated with A. lappa extract. Dose-dependent inhibition of Colo-205 cell viability following treatment with varying concentrations of A. lappa ethanolic extract for 72 hours. D) IC₅₀ values of A. lappa extract and E) cisplatin on Colo-205 cell viability, with cisplatin exhibiting an IC₅₀ value of 8.40 µg/mL and A. lappa extract showing an IC₅₀ of 11.80 µg/mL, F) A. lappa showed with an IC₅₀ of 1485 µg/mL for normal HSF, G) Comparison of cytotoxicity between cisplatin and A. lappa extract on Colo-205 cells. A. lappa showed selective cytotoxicity against Colo-205 cells, H) A. lappa showed with a higher IC₅₀ for normal HSF than for Colo-205 cells.

Abbreviations: HSF: human skin fibroblasts, IC50: Half Maximal Inhibitory Concentration

Effects of A. lappa on the Propagation of Colorectal Cancer Cells in vitro

The results from the SRB assay demonstrated that A. lappa extract exhibited a strong inhibitory effect on the growth of Colo-205 colorectal cancer cells following treatment for 24, 48, and 72 hours (Figure 2 ). The ethanolic extract of A. lappa showed significant anti-proliferative activity, with an IC₅₀ value of 11.80 µg/mL, as depicted in Figure 2A–E. Notably, a dose-dependent decrease in Colo-205 cell viability was observed with increasing concentrations of A. lappa extract (Figure 2A–D). In contrast, A. lappa did not induce cytotoxicity in normal human skin fibroblasts (HSF), with an IC₅₀ value of 1478 µg/mL, suggesting a degree of selectivity for cancer cells. For comparison, the reference anticancer drug cisplatin demonstrated an IC₅₀ value of 8.40 µg/mL against Colo-205 cells, while showing much higher cytotoxicity toward normal cells, with an IC₅₀ value of 645.7 µg/mL (Figure 2F). These findings highlight the potential of A. lappa as a promising anticancer agent with selective cytotoxicity against colorectal cancer cells while sparing normal cells. The results showed that A. lappa has a strong inhibitory effect on Colo-205 human colorectal cancer cells but no toxicity or effects on proliferation in normal cells (HSF) (Figure 2A-H).

Figure 3

Western blot analysis showing the expression of MMP-2 in Colo-205 cells treated with varying concentrations of A. lappa extract for 72 hours. The bands corresponding to MMP-2 were detected, and the expression level was quantified relative to GAPDH. A) Western blot analysis showing the expression of MMP-9 in Colo-205 cells treated with A. lappa extract. The bands corresponding to MMP-9 were observed, with quantification against the housekeeping protein for normalization. B) Calculation of MMP-2 and MMP-9 levels based on their molecular weights. Densitometric analysis was performed to quantify the expression of MMP-2 and MMP-9 in treated cells, with values normalized to the loading control. The relative expression of MMP-2 and MMP-9 is shown as fold changes compared to untreated (control) cells.

Abbreviations: GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase, MMP: Matrix Metalloproteinase, GI, GII, GIII and GIV: Group I, II, III and IV

MMP-2 and MMP-9 Expression

Western blot analysis specified markedly elevated expressions of MMP-2 and MMP-9 proteins in COLO-205 cells compared to HSF cells. However, when treated with burdock extract, the cells exhibited signs of recovery, as shown in (Figure 3). Western blot analysis was accomplished to appraise the expressions of MMP-2 in COLO-205 cancer cells under treatment conditions (Figure 3). Densitometric analysis revealed that control cells exhibited baseline MMP-2 expression (3.28%), with minimal change observed in the A. lappa-treated control group (3.47%). Notably, cancer induced a substantial upregulation of MMP-2 expression to 13.94%, corresponding to an approximate 4.25-fold increase relative to control conditions. Treatment with A. lappa resulted in MMP-2 expression levels of 10.23%, reflecting an approximate 1.36-fold reduction in MMP-2 expression compared to untreated conditions. This indicates that A. lappa effectively mitigates the elevated MMP-2 levels associated with cancer.

Western blot analysis was performed to examine Matrix Metalloproteinase-9 (MMP-9) expression levels in COLO-205 cancer cells under treatment conditions (Figure 3). Densitometric analysis normalized to β-actin revealed baseline MMP-9 expression in control cells (5.08%). Treatment with A. lappa alone showed a slight increase in MMP-9 expression (6.16%), representing a 1.21-fold increase compared to HSF. Notably, cancer induced a substantial upregulation of MMP-9 expression (15.06%), corresponding to a 2.96-fold increase relative to control conditions. Treatment with A. lappa resulted in MMP-9 expression levels of 11.24%; this reflects an approximate 1.34-fold reduction in MMP-9 expression compared to untreated conditions.

Figure 4

ELISA analysis showing the expression levels of (A) Caspase-3 and Caspase-9 in Colo-205 cells treated with A. lappa extract. B) Gene Expression analysis of apoptosis-regulatory genes P53, BAX, BCL-2, and NF-κB in A. lappa-treated Colo-205 cells. The expression levels of pro-apoptotic (BAX, P53) and anti-apoptotic (BCL-2) proteins, as well as NF-κB, were assessed. C) Quantification of inflammatory cytokines (TNF-α, IL-1β, and IL-6) in the cell culture supernatants from Colo-205 cells treated with A. lappa extract, measured by ELISA. The levels of these pro-inflammatory cytokines were quantified and compared to untreated controls. Cytokine concentrations are expressed in pg/mL.

Abbreviation: ELISA: Enzyme-Linked Immunosorbent Assay

Caspase-3 and 9

To further investigate the effects of A. lappa treatment, we measured the mRNA levels of pro-apoptotic and anti-apoptotic genes using qRT-PCR in COLO-205 cells, after 24 hours of treatment with A. lappa at IC₅₀ concentrations. The caspase-3, caspase-9 (Figure 4A), P53, and BAX expressions (Figure 4B) were upregulated by 4.07, 3.66, 2.69, and 22.44-fold, respectively, following A. lappa treatment. In contrast, the mRNA expression of the anti-apoptotic protein BCL-2 was downregulated by 13.33-fold in COLO-205 cell lines after A. lappa treatment, as depicted in (Figure 4B).

A. lappa Inhibited COLO-205 Proliferation through NF-κB In Vitro

To gain a greater understanding of the mechanisms behind the suppressive effects of A. lappa on COLO-205 cell growth and migration, we investigated the levels of the NF-κB signaling pathway. The findings revealed a dose-dependent reduction in NF-κB expression following A. lappa treatment, suggesting a potential connection between A. lappa's actions on COLO-205 cells and the NF-κB pathway (Figure 4B).

TNF-α, IL-1β, and IL-6

A. lappa induced a significant reduction in the inflammatory cytokines (IL-6, IL-1β, and TNF-α) of the cell supernatant, as shown (Figure 4C). These findings showed that A. lappa might decrease inflammatory cytokine release from the human COLO-205.

Comet Assay

The comet assay provided critical insights into DNA damage induced by Arctium lappa ethanol extract. At a concentration of 100 µg, the extract significantly altered DNA structural integrity in Colo-205 cells, demonstrating its potent genetic impact. Quantitative analysis revealed a marked increase in DNA migration within comet tails. The tail moment escalated dramatically from 2.03 ± 0.03 in the negative control to 18.88 ± 0.86 after extract treatment. Similarly, DNA migration in comet tails increased from 1.33 ± 0.05% to 4.36 ± 0.33% (Table 3 and Figure 5A-D).

Table 3

Effects of Arctium lappa on Genomic DNA in HSF and COLO-205 Cell Lines

Groups

Normal (GI)

A. lappa (GII) on normal cells

COLO- 205 (GIII)

Treatment with A. lappa (GIV)

F value

Tail DNA (%)

1.00 ± 0.02c

0.90 ± 0.02b

1.33 ± 0.05ab

4.36 ± 0.33a

9.148*

Untailed (%)

96.74 ± 0.52a

95.82 ± 0.75a

92.77 ± 0.59b

78.30 ± 0.89c

71.133*

Tail length (µm)

1.03 ± 0.03c

1.00 ± 0.01c

1.30± 0.02b

5.90 ± 0.37a

27.594*

Tail moment

1.26 ± 0.04c

1.54 ± 0.06c

2.03 ± 0.03b

18.88 ± 0.86b

101.39*

Figure 5

Comet assay for experimental groups. A) Normal cells (human skin fibroblasts), showing baseline DNA integrity, B) H-Colo-205 cells, demonstrating baseline DNA damage in colorectal cancer cells; C) Effect of A. lappa on H-Colo-205 cells, showing DNA fragmentation indicative of apoptosis or genotoxicity induced by the extract; D) Effect of A. lappa on HSF cells, showing minimal DNA damage in normal cells, indicating selective toxicity toward cancer cells.

Figure 6

Molecular docking experiment showing the interactions between arctigenin (the active compound from A. lappa) and TGF-βRI. 2D and 3D depictions of the binding interactions between arctigenin and the co-crystallized inhibitor with TGF-βRI, illustrating the potential binding sites and affinity of arctigenin as a therapeutic agent targeting the TGF-β receptor. The docking results highlight key interactions that may contribute to the anticancer and anti-inflammatory properties of A. lappa.

Table 4

Molecular Docking Interactions of Arctigenin with TGF-βRI

Compound

Binding Energy (kcal/mol)

Hydrogen Bonds (Residues)

Residual Interactions

Arctigenin

-8.5

2 (Lys232, Glu245)

Val219, Leu340, Phe216, Leu278, Leu260, Lys232

Co-crystallized Inhibitor

-11.3

2 (Asp351, His283)

Val219, Leu340, Ala230, Leu260, Tyr249, Ser280, Leu278, Val279

Molecular Docking Experiment

In the current study, arctigenin from Arctium lappa demonstrated suppressed cancer development in vitro. This finding is supported by the in silico study results, where arctigenin could bind to the TGF-βR1 cavity similar to its co-crystallized inhibitor, as shown in (Figure 6& Table 4). Arctigenin formed two hydrogen bonds (residues Glu245 and Lys232 with bond lengths of 2.63 Å and 2.89 Å) within the receptor cavity, stabilizing arctigenin. It also exhibited other interactions like van der Waals and π-π interactions with residues resembling those involved with the co-crystallized inhibitor, such as Leu278, Leu260, Val219, and Lys232. These hydrogen bonds and other interactions collectively contribute to stabilizing arctigenin within the cavity of TGF-βR1, inhibiting its kinase function and subsequently suppressing the signal pathway that induces other genes involved in cancer proliferation.

Discussion

The study conducted provides supporting evidence for the potential effectiveness of Arctium lappa in combating cancer. The ethanol extract of A. lappa demonstrated noteworthy inhibition of COLO-205 cell growth and proliferation, indicating its potential as an antiproliferative agent. These results are consistent with previous research that has highlighted the anticancer properties of A. lappa. Particularly promising is the selective cytotoxicity of A. lappa towards cancer cells, as it exhibited no cytotoxic effects on normal HSF cells, suggesting its specificity in targeting cancerous cells. This selective action is crucial in the development of effective treatments while minimizing harm to healthy cells. Notably, Machado17 discovered that the ethanol (EtOH) extract from A. lappa and its ethyl acetate fraction demonstrated a greater suppression of HSF growth compared to other extracts. Similarly, Taleb Agha et al.18 indicated that the ethyl extract of A. lappa substantially reduced MCF-7 proliferation and exhibited antimutagenic activity with an IC of 50.18 ± 3.66 μg/ml. These outcomes agree with prior research on the anticancer potential of A. lappa.

In our study, the IC value of the A. lappa ethanol extract was determined, and it was found that compounds such as lignans, terpenoids, and sterols have varying pharmacological effects on cancer and pathological angiogenesis18. Phytosterols, such as stigmasterol and β-sitosterol, have been shown in numerous investigations to possess anticancer properties through diverse modes of action, including reducing cancer cell development and triggering tumorigenesis or cancer cell death19. Therefore, these chemicals could contribute to the anti-proliferative effect of A. lappa. Additionally, the fractionation of polyphenol compounds using HPLC of Arctium lappa by Ionescu et al.20, exhibited the occurrence of compounds like caffeic acid, ferulic acid, chlorogenic acid, cinaric acid, and cichoric acid, as well as flavone compounds like rutin, quercetin, quercitrin, luteolin, and apigenin.

The study also delved into the underlying mechanisms through which A. lappa exerts its anticancer effects. The observed downregulation of MMP-2 and MMP-9 expression in COLO-205 cells suggests a potential role of A. lappa in suppressing tumor metastasis and invasion. MMPs play a critical function in these processes, and inhibiting their activity can be a promising strategy for preventing cancer spread21. Moreover, regulating the NF-κB signaling pathway by A. lappa further supports its anticancer potential. The reduction in NF-κB expression and subsequent decline in inflammatory cytokines (IL-1β, TNF-α, and IL-6) suggest that A. lappa may possess anti-inflammatory properties22, 23.

While genotoxic effects were observed in the comet assay, indicating that the A. lappa extract induces DNA damage in COLO-205 cells, it is important to note that genotoxicity is desirable in cancer cells as it can contribute to their growth inhibition and destruction24. Nevertheless, additional investigations are necessitated to clarify the specific mechanisms of DNA damage induced by A. lappa. The presence of arctigenin, a bioactive compound found in A. lappa, enhances its potential as an anticancer agent. Arctigenin has been associated with antioxidant, anti-inflammatory, and anticancer properties25. Molecular docking experiments have verified arctigenin's capacity to inhibit the TGF-βR1 signaling pathway, which is involved in cancer proliferation26, 27. This suggests that arctigenin is crucial for the overall anticancer properties of A. lappa. Furthermore, the upregulation of pro-apoptotic genes like P53, caspase-3, caspase-9, and BAX, along with the downregulation of the anti-apoptotic gene Bcl-2, further supports the capacity of A. lappa to promote apoptosis in COLO-205 cells. The regulation of apoptosis is a critical process for controlling cancer cell growth and survival28, 29.

Even though our current in vitro study strongly suggests that Arctium lappa extract may help fight cancer, we are aware of the limitations of cell-based research. We need more research to fully understand the extract's healing properties, even though the controlled cellular environment was helpful for early mechanistic studies.

Future research should prioritize in vivo testing to validate the current studies and ensure their potential clinical utility. To figure out how the Arctium lappa extracts fight cancer, we will have to use experimental animals and the newest molecular methods. In particular, we focus on looking at dose-response relationships, possible interactions with other drugs, and carrying out an overall pharmacological assessment.

In this context, our study is an important first step in identifying the potential of Arctium lappa as an effective anticancer drug. Since there is room for more research, our goal is to lay the groundwork for future studies that can use the favorable results in vitro to focus on cancer therapies in particular. This strategy preserves the scientific rigor of the investigation, acknowledges its clinical relevance and scope for its reproduction, points out the significance of the present results, and prescribes mechanisms for further advancement of the area.

Conclusions

The findings suggest that A. lappa has significant anti-tumor activity and could be a good source of anticancer compounds. Additional investigations are necessary to explore the underlying mechanisms and optimize the use of A. lappa for anticancer therapies.

Abbreviations

ABTS: 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ANOVA: Analysis of Variance, BAX: BCL2-Associated X Protein, BCL-2: B-cell lymphoma 2, cDNA: Complementary DNA, CO₂: Carbon dioxide, CP: Cisplatin, DMSO: Dimethyl sulfoxide, DPPH: 1,1-diphenyl-2-picrylhydrazyl, DTT: Dithiothreitol, ECL: Enhanced Chemiluminescence, EDTA: Ethylenediaminetetraacetic acid, ELISA: Enzyme-Linked Immunosorbent Assay, EtOH: Ethanol, FBS: Fetal Bovine Serum, GAE: Gallic Acid Equivalents, HBM8-k562: Human Bone Marrow Cells (K562 leukemia cell line), H-COLO-205: Human Colorectal Carcinoma Cells (Colo-205 cell line), HMM: Human Multiple Myeloma, HPLC: High-Performance Liquid Chromatography, HRP: Horseradish Peroxidase, HSF: Human Skin Fibroblast, HTB-43: Human Oral Cavity Cancer Cells, Huh-7: Human Hepatocellular Carcinoma Cells, IC₅₀: Half Maximal Inhibitory Concentration, IL-1β: Interleukin-1 Beta, IL-6: Interleukin-6, MMP-2: Matrix Metalloproteinase-2, MMP-9: Matrix Metalloproteinase-9, NF-κB: Nuclear Factor Kappa B, OD: Optical Density, P53: Tumor Protein 53, PBS: Phosphate-Buffered Saline, PCR: Polymerase Chain Reaction, PDB: Protein Data Bank, qRT-PCR: Quantitative Reverse Transcription Polymerase Chain Reaction, RP: Reducing Power, SAS: Statistical Analysis System, SDS: Sodium Dodecyl Sulfate, SEM: Standard Error of the Mean, SRB: Sulforhodamine B, TBS: Tris-Buffered Saline, TBST: Tris-Buffered Saline with Tween 20, TCA: Trichloroacetic Acid, TEAC: Trolox Equivalent Antioxidant Capacity, TEMED: Tetramethylethylenediamine, TFC: Total Flavonoid Content, TGF-βR1: Transforming Growth Factor Beta Receptor 1, TNF-α: Tumor Necrosis Factor Alpha, UV-Vis: Ultraviolet-Visible

Acknowledgments

The authors are grateful to Nawah Scientific Center, especially for providing the cells and facilitating work.

Author’s contributions

Ibrahim I. Bondouk and Hosam M. Saleh prepared the extract of Arctium lappa. Ibrahim I. Bondouk and Hosam M. Saleh and Mohamad Taha Abdelrahman performed the in vitro experiment on the extract, analyzed the extract phenols, and flavonoid content, and determined the in vitro antioxidant characteristics. Mohamed Taha Abdelrahman performed the molecular docking experiment. Amal I. Hassan performed the biological experiment on the cells and the statistical data. All authors were involved in the data management, statistics, writing, and reviewing of the manuscript. All authors read and approved the final manuscript.

Funding

None.

Availability of data and materials

Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  1. P. Rawla, T. Sunkara, A. Barsouk. Epidemiology of colorectal cancer: incidence, mortality, survival, and risk factors. Przeglad Gastroenterologiczny 2019; 14(2): 89-103.
  2. P.D. Fontana, L. Bavia, F. Bovo, A.R. de Souza, M.L. Corazza, I.J. Messias-Reason. Supercritical Extracts from Arctium lappa as a Potential Inhibitor for the Activation of Complement System. Planta Medica International Open 2019; 6(02): e63-9.
  3. A.A. Siddiqui, J. Amin, F. Alshammary, E. Afroze, S. Shaikh, H.A. Rathore. Burden of Cancer in the Arab World. In: Laher, I. (eds) Handbook of Healthcare in the Arab World. Springer, Cham. : 495-519.
  4. Y.O. Ayipo, C.F. Chong, H.T. Abdulameed, M.N. Mordi. Bioactive alkaloidal and phenolic phytochemicals as promising epidrugs for diabetes mellitus 2: A review of recent development. Fitoterapia 2024; 175: 105922.
  5. A. N Adham, M.E. F Hegazy, A.M. Naqishbandi, T. Efferth, N. Adham A. Induction of apoptosis, autophagy and ferroptosis by Thymus vulgaris and Arctium lappa extract in leukemia and multiple myeloma cell lines. Molecules (Basel, Switzerland) 2020; 25(21): 5016.
  6. M. Ali, R. Iqbal, M. Safdar, S. Murtaza, G. Mustafa, M. Sajjad. Antioxidant and antibacterial activities of Artemisia absinthium and Citrus paradisi extracts repress viability of aggressive liver cancer cell line. Molecular Biology Reports 2021; 48(12): 7703-10.
  7. K.H. Kim, R. Tsao, R. Yang, S.W. Cui. Phenolic acid profiles and antioxidant activities of wheat bran extracts and the effect of hydrolysis conditions. Food Chemistry 2006; 95(3): 466-73.
  8. M. Atanassova, S. Georgieva, K. Ivancheva. Total phenolic and total flavonoid contents, antioxidant capacity and biological contaminants in medicinal herbs. Journal of the University of Chemical Technology & Metallurgy 2011; 46(1): 81-88.
  9. C.V. Vázquez, M.G. Rojas, C.A. Ramírez, J.L. Chávez-Servín, T. García-Gasca, R.A. Ferriz Martínez. Total phenolic compounds in milk from different species. Design of an extraction technique for quantification using the Folin-Ciocalteu method. Food Chemistry 2015; 176: 480-6.
  10. M.S. Blois. Antioxidant determinations by the use of a stable free radical. Nature 1958; 181(4617): 1199-200.
  11. M.B. Arnao, A. Cano, J.F. Alcolea, M. Acosta. Estimation of free radical-quenching activity of leaf pigment extracts. Phytochemical Analysis 2001; 12(2): 138-43.
  12. T. Kuda, M. Tsunekawa, T. Hishi, Y. Araki. Antioxidant properties of driedkayamo-nori', a brown alga Scytosiphon lomentaria (Scytosiphonales, Phaeophyceae). Food Chemistry 2005; 89(4): 617-22.
  13. M.M. Burtscher, L.A. May, C.A. Downs, T. Bartlett. Zooxanthellae Viability Assay. Diseases of Coral 2015; : 524-37.
  14. L. Zhang, X. Lin, J. Wang, F. Jiang, L. Wei, G. Chen. Effects of lead and mercury on sulfate-reducing bacterial activity in a biological process for flue gas desulfurization wastewater treatment. Scientific Reports 2016; 6(1): 30455.
  15. N.P. Bonjoch, P.R. Tamayo. Protein content quantification by Bradford method. InHandbook of plant ecophysiology techniques 2001; : 283-295.
  16. J. Winer, C.K. Jung, I. Shackel, P.M. Williams. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Analytical Biochemistry 1999; 270(1): 41-9.
  17. F.B. Machado, R.E. Yamamoto, K. Zanoli, S.R. Nocchi, C.R. Novello, I.T. Schuquel. Evaluation of the antiproliferative activity of the leaves from Arctium lappa by a bioassay-guided fractionation. Molecules (Basel, Switzerland) 2012; 17(2): 1852-9.
  18. M. Taleb Agha, H.M. Baharetha, M.A. Al-Mansoub, Y.M. Tabana, N.H. Kaz Abdul Aziz, M.F. Yam. Proapoptotic and antiangiogenic activities of Arctium lappa L. on breast cancer cell lines. Scientifica 2020; 2020(1): 7286053.
  19. I. Sánchez-Crisóstomo, E. Fernández-Martínez, R. Cariño-Cortés, G. Betanzos-Cabrera, R.A. Bobadilla-Lugo. Phytosterols and triterpenoids for prevention and treatment of metabolic-related liver diseases and hepatocellular carcinoma. Current Pharmaceutical Biotechnology 2019; 20(3): 197-214.
  20. K.A. Elghobashy, M.M. Eldanasoury, A.A. Elhadary, M. Farid. Phytochemical constituent, HPLC profiling and antioxidant activity of Passiflora incarnata and Arctium lappa leaves extracts. International Journal of Veterinary Science 2020; 9: 42-9.
  21. R. Zheng, F. Li, F. Li, A. Gong. Targeting tumor vascularization: promising strategies for vascular normalization. Journal of Cancer Research and Clinical Oncology 2021; 147(9): 2489-505.
  22. J.F. Rossi, Z.Y. Lu, C. Massart, K. Levon. Dynamic immune/inflammation precision medicine: the good and the bad inflammation in infection and cancer. Frontiers in Immunology 2021; 12: 595722.
  23. Y. Xiong, X. Cui, Y. Zhou, G. Chai, X. Jiang, G. Ge. Dehydrocostus lactone inhibits BLM-induced pulmonary fibrosis and inflammation in mice via the JNK and p38 MAPK-mediated NF-κB signaling pathways. International Immunopharmacology 2021; 98: 107780.
  24. H. Barabadi, M. Najafi, H. Samadian, A. Azarnezhad, H. Vahidi, M.A. Mahjoub. A systematic review of the genotoxicity and antigenotoxicity of biologically synthesized metallic nanomaterials: are green nanoparticles safe enough for clinical marketing?. Medicina (Kaunas, Lithuania) 2019; 55(8): 439.
  25. S. Qiao, C. Lv, Y. Tao, Y. Miao, Y. Zhu, W. Zhang. Arctigenin disrupts NLRP3 inflammasome assembly in colonic macrophages via downregulating fatty acid oxidation to prevent colitis-associated cancer. Cancer Letters 2020; 491: 162-79.
  26. M. Lahn, S. Kloeker, B.S. Berry. TGF-β inhibitors for the treatment of cancer. Expert Opinion on Investigational Drugs 2005; 14(6): 629-43.
  27. Y. Wang, X. Li, S. Pu, X. Wang, L. Guo, L. Zhang. Ameliorative Effects of Arctigenin on Pulmonary Fibrosis Induced by Bleomycin via the Antioxidant Activity. Oxidative Medicine and Cellular Longevity. 2022; 2022(1): 3541731.
  28. Y. Sun, Y.J. Tan, Z.Z. Lu, B.B. Li, C.H. Sun, T. Li. Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα. Frontiers in Pharmacology 2018; 2018: 268.
  29. S. Patergnani, A. Danese, E. Bouhamida, G. Aguiari, M. Previati, P. Pinton. Various aspects of calcium signaling in the regulation of apoptosis, autophagy, cell proliferation, and cancer. International Journal of Molecular Sciences 2020; 21(21): 8323.

Comments