This study was conducted on patient samples collected from the member hospitals of the Jiangsu Provincial PBC Collaboration Group (JSPPCG) as part of a genome-wide association study7. PBC patients were recruited according to the guidelines of the Declaration of Helsinki (2008). The diagnosis of PBC was based on the following criteria: AMA positive (PDC-E2, BCOADC-E2, or OGDC-E2); AMA negative, anti-sp100 or -gp210 positive, with elevated alkaline phosphatase; or antibody negative, but with histological evidence and elevated alkaline phosphatase. Since a liver biopsy was not conducted for most patients, those who tested negative for AMA, sp100, and gp210 antibodies and did not undergo biopsy were excluded.

Biochemical test records for 780 of the 1096 PBC patients in this study were included at the time of disease onset (Supplementary table 1). Of these 780 patients, 666 were female (85.38%) and 114 were male (14.62%). The median age of the patients was 55.9 years. Patients who had received ursodeoxycholic acid (UDCA) at a daily dose of 13 to 15 mg/kg of body weight and had at least 1 year of follow-up were selected to evaluate their response to UDCA. The biochemical response to treatment was evaluated according to the Barcelona (BA) and Paris I (PA) criteria8.

For plasmid construction, homologous recombination/ET cloning was used to insert gene into the expression vectors9. pET28a with 6×His tag was used to clone human with the following primers (PDC-E2. FP: 5’-CAGCCATCATCATCATCATCA CGGATCCAGTCTTCCCCCGCATCAGAA, PDC-E2.RP: 5’-TGCTCGAGTGCGGCCGCAA GCTTCATTACAACAACATAGTGATAG; BCOADC-E2. FP: 5’-CATCATCATCATCATCACGGAT CCGGACAGGTTGTTCAGTTCAA-3’; BCOADC-E2.RP: 5’-GTGGTGGTGGTGGTGCTCG AGTTCAATCTAGTAGCATAAAAGCTGG-3’; OGDC-E2. FP: 5’-ACTTTAAGAAGGAGATATA CCATGGATGACTTGGTTACAGTC-3’; OGDC-E2.RP: 5’-GTGGTGGTGGTGGTGGTGCTC GAGAAGATCCAGGAGGAGGACTCTG-3’).

RNA from human liver cells (HepG2) served as the template for cDNA preparation by reverse transcribed-polymerase chain reaction (RT-PCR) using the oligos (dT) primer. PCR was performed using the high-fidelity LA Taq polymerase (TaKaRa, China). The DNA sequence of the constructed plasmid was verified by DNA sequencing analysis. Plasmids were transformed into BL21 competent cells. The transformed cells were grown at 37°C overnight in Luria-Bertani medium containing 50 µg/mL ampicillin and induced with 1mM isopropylthiogalactoside (IPTG) overnight at 25°C. PDC-E2 was purified from under native conditions by Ni-NTA agarose (QIAGEN, Germany) with elution buffer (50 mM NaHPO, 300 mM NaCl, 250 mM imidazole, pH 8.0). The eluted proteins were loaded to the HiLoad 26/600 Superdex 75 PG column (GE Healthcare Bio-Sciences AB, Sweden) for the final purification of PDC-E2, BCOADC-E2 and OGDC-E2.

Gel-purified proteins (antigens) (1 µg/mL) were suspended in 50 mM carbonate buffer (pH 9.6) and coated onto microtiter plates (Thermo-Fisher, USA) overnight at 4°C for enzyme-linked immunosorbent assay (ELISA). After blocking with 1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS), the plates were incubated with sera (1:2000 dilution) for 2 hours at room temperature and then washed five times with PBS containing 0.1% Tween-20 (PBST). Peroxidase-conjugated anti-human immunoglobulin (IgG, IgM, and IgA) antibody (Millipore, Temecula, USA) was added to the plates (1:30,000 dilution, 100 µL/well) and then incubated for 2 hours at room temperature. After washing six times with PBST, 3,3′,5,5′-tetramethylbenzidine (TMB) was added as the substrate, and 2 M sulfuric acid was added as the stop solution. The optical density (OD) was measured using an ELISA plate reader (Bio-Rad, USA) at 450 nm. Reactivity against AMAs was also assessed using commercially available ELISA kits (Shanghai Kexin Biotech Co., Shanghai, China).

All statistical analyses were performed using SPSS version 19.0 for Windows (SPSS, Inc., Chicago, IL). Values were expressed as the mean ± SD. A P value less than 0.05 was considered statistically significant for all tests. The Mann-Whitney U-test was used to compare quantitative variables between two groups, and the χ² test was used to compare categorical variables.

Table 1

	All Patients (n=1096)
Antigens	Positive Patients	Prevalence
PDC-E2+	944	86.13%
BCOADC-E2+	923	84.21%
OGDC-E2+	446	40.70%
PDC-E2+/BCOADC-E2+/OGDC-E2+	372	33.94%
PDC-E2 + /BCOADC-E2+	793	72.35%
PDC-E2+/OGDC-E2+	405	36.95%
BCOADC-E2+/OGDC-E2+	406	37.04%
PDC-E2+ alone	118	10.77%
BCOADC-E2 + alone	96	8.76%
OGDC-E2+ alone	7	0.64%
At least 1 of them +	1081	98.63%
All negative	15	1.37%

Abbreviations: PDC: pyruvate dehydrogenase complex; BCOADC: branched chain 2-oxo-acid dehydrogenasecomplex; OGDC: 2-oxo-glutaric acid dehydrogenase complex; E2: enzyme subunit.

The overall prevalence of AMA to PDC-E2, BCOADC-E2, and OGDC-E2 is summarized in Table 1. In this study, 1081 patients were immunoreactive to at least one of the three 2-OADC components. Anti-PDC-E2 was the most frequently detected AMA, while anti-OGDC-E2 was the least prevalent among the three 2-OADC components. Notably, the prevalence of anti-BCOADC-E2 was 84.21% in Chinese PBC patients, which was much higher than the prevalence observed in Caucasian PBC patients (64.32%)10. Approximately one-third of patients were simultaneously reactive to PDC-E2, BCOADC-E2, and OGDC-E2.

Table 2

Clinical Features	Anti-PDC-E2			Anti-BCOADC-E2			Anti-OGDC-E2
	Positive (673)	Negative (107)	P value	Positive (657)	Negative (123)	P value	Positive (316)	Negative (464)	P value
Age	56.0 ± 11.5	55.4 ± 10.4	0.461	56.0 ± 11.1	55.0 ± 12.7	0.484	56.5 ± 11.3	55.5 ± 11.3	0.286
Sex (F/M)	571/102	95/12	0.284	554/103	112/11	0.052	262/54	404/60	0.107
ALT (IU/L)	121.6 ± 217.1	140.4 ± 165.5	0.039	120.	145.9 ± 207.2	0.172	105.2 ± 128.2	137.1 ± 251.4	0.156
AST (IU/L)	120.0 ± 184.0	123.2 ± 144.0	0.890	114.9 ± 152.4	150.1 ± 280.6	0.795	110.3 ± 112.6	127.3 ± 212.6	0.891
GGT (U/L)	357.0 ± 308.7	387.0 ± 317.6	0.443	370.0 ± 314.4	312.5 ± 280.5	0.022	369.7 ± 337.5	355.2 ± 289.9	0.799
ALP (U/L)	339.1 ± 223.4	319.0 ± 197.4	0.285	343.9 ± 221.5	296.2 ± 208.0	0.003*	347.5 ± 231.6	328.8 ± 211.7	0.220
TB (μmol/)	44.6 ± 591	50.5 ± 94.5	0.234	47.1 ± 66.8	36.2 ± 54.2	＜0.001*	42.5 ± 57.8	47.3 ± 69.6	0.919
DB (μmol/)	28.5 ± 45.9	32.1 ± 75.7	0.072	30.5 ± 52.9	20.8 ± 38.0	＜0.001*	27.3 ± 46.2	30.2 ± 54.0	0.835
TP (g/L)	73.7 ± 9.7	73.4 ± 12.3	0.760	73.7 ± 10.3	73.5 ± 8.7	0.634	74.7 ± 9.7	72.9 ± 10.3	0.007*
ALB (g/L)	37.7 ± 7.3	39.4 ± 6.6	0.018	37.8 ± 7.2	38.7 ± 6.8	0.223	37.6 ± 7.6	38.1 ± 6.9	0.149

*P < 0.01. Mann-Whitney U test was performed to calculate P values. PDC: pyruvate dehydrogenase complex; BCOADC: branched chain 2-oxo-acid dehydrogenase complex; OGDC: 2-oxo-glutaric acid dehydrogenase complex; E2: enzyme subunit; ALT: alanine aminotransferase; AST: aspartate aminotransferase; GGT: gamma-glutamyl transferase; ALP: alkaline phosphatase; TB: total bilirubin; DB: direct bilirubin; TP: total protein; ALB: albumin.

The biochemical results at disease onset were summarized according to the reactivity of various AMAs (Table 2). There were no statistical differences in most of the biochemical indices among AMAs, except that increased total bilirubin (TB) and alkaline phosphatase (ALP) concentrations are significantly associated with anti-BCOADC-E2 positivity (P < 0.001 and P = 0.003, respectively), and that increased protein concentration is significantly correlated with anti-OGDC-E2 positivity (P = 0.007).

Table 3

Patients ID	Gender	Age at disease onset (years)	Age at treatment (years)	Period of treatment (Months)	PDC-E2		BCOADC-E2		OGDC-E2
					Before	After	Before	After	Before	After
Patient 1	Male	46	51	20	>1:16,000	1:2,000	>1:16,000	-	1:4,000	1:500
Patient 2	Female	68	71	30	-	-	1:16,000	1:1,000	-	-
Patient 3	Female	42	43	23	1:16,000	1:8,000	>1:8,000	-	-	-
Patient 4	Female	46	47	26	>1:8,000	>1:8,000	>1:8,000	1:4,000	1:2,000	1:2,000
Patient 5	Female	50	50	16	>1:8,000	>1:8,000	>1:8,000	>1:8,000	1:1,000	1:1,000
Patient 6	Female	48	48	16	-	-	1:8,000	1:8,000	-	-
Patient 7	Female	53	60	18	-	-	>1:8,000	1:8,000	-	-
Patient 8	Female	57	60	31	>1:8,000	1:4,000	1:4,000	1:1,000	1:8,000	1:8,000
Patient 9	Female	53	62	32	1:4,000	1:500	1:16,000	1:500	-	-
Patient 10	Female	59	60	22	1:2,000	1:2,000	1:1000	1:1,000	-	-

The results in the antibody concentration represent the highest dilution level when positivity was detected. “-” represents negative result.

Figure 1

In the course of evaluating our AMA antibody ELISA assay, we unexpectedly found inconsistent anti-BCOADC-E2 results in a patient's blood samples collected at two different times. To assess whether anti-BCOADC-E2 titer can be affected by UDCA treatment, we performed a semi-quantitative analysis of AMA titers in PBC patients during the course of UDCA treatment. In ten initially anti-BCOADC-E2-positive patients studied, seven were positive for anti-PDC-E2 prior to treatment, and four were positive for anti-OGDC-E2 (Table 3). Over 15–30 months of treatment, steady decreases in anti-BCOADC-E2 titers were observed in five patients (Figure 1). Among them, two patients became negative for anti-BCOADC-E2 after 20–23 months of treatment. We compared the changes in PDC-E2 and OGDC-E2 antibody titers in these patients in parallel. A decrease in antibody titers for all three AMAs (PDC-E2, BCOADC-E2, and OGDC-E2) was observed in patient 1. A decrease in anti-PDC-E2 was also observed in patient 9, in parallel with the decrease in anti-BCOADC-E2. No significant changes in PDC-E2 and OGDC-E2 antibody titers were detected in the remaining patients analyzed (Supplementary Figures S1 & S2).

PDC-E2 was first identified and cloned in 1987 by Gershwin and his colleagues as the main M2 antigenic component of AMA. Later, other members of the 2-OADC complex (BCOADC-E2 and OGDC-E2) were confirmed as constituents of the ‘M2’ family of mitochondrial antigens5, 11. Antibodies to PDC-E2 are the most frequently detected antibodies in Chinese PBC patients, with prevalence similar to that observed in Caucasian PBC patients. The prevalence of anti-BCOADC-E2 is much higher in Chinese PBC patients (84.21%) than in Caucasian PBC patients (64.32%)10. Our results indicate ethnic or geographical variations in the prevalence of AMA antibodies against PDC-E2, BCOADC-E2 and OGDC-E2.

Currently, possible reasons for the higher anti-BCOADC-E2 positivity in Chinese PBC patients may include the high prevalence of hepatitis virus infection in China, limited access to AMA testing in non-metropolitan clinics, and inadequate medical training among clinicians in rural areas, which may lead to delayed or missed diagnoses among many PBC patients12. Due to financial difficulties, many PBC patients cannot afford UDCA treatment and opt for herbal treatments13. These factors may increase the percentage of patients without proper treatment, thus contributing to higher anti-BCOADC-E2 positivity.

In this study, we compared the initial biochemical results of PBC patients with their AMA status. As reported previously by the Gershwin group, anti-PDC-E2 positivity did not correlate with any biochemical index14. However, surprisingly, we found significant association of anti-BCOADC-E2 status with bilirubin concentration. PBC patients positive for anti-BCOADC-E2 antibody showed increased initial total bilirubin and direct bilirubin concentration in the blood, compared to patients negative for anti-BCOADC-E2 antibody. Although our cohort is large and the statistical association is robust, further validation in independent datasets is needed to confirm the generalizability of this finding.

We further performed semi-quantitative analysis of three AMA antibody concentrations during the UDCA treatment. To our surprise, steady decrease in anti-BCOADC-E2 titer was observed in five out of ten patients. After 15–30 months, two patients became negative for anti-BCOADC-E2. A previous study by the Gershwin group also analyzed these three antibodies in 20 patients over 7–28 years. They found no significant changes in antibody titers for PDC-E2, BCOADC-E2 and OGDC-E2 between sera collected at the beginning and end of observation. However, a few significant changes were observed in the study, in which the anti-IgG and anti-IgM antibodies to BCOADC-E2 showed a decrease, although authors did not elaborate in detail14. In their report, the authors did not mention clearly whether the initial patient samples were collected at the beginning of the UDCA treatment. Different from their report, the initial blood samples analyzed in our time course analysis were collected when AMA was first found to be positive in the patient and/or within the first month of initial UDCA treatment. Blood samples in our study were collected in a relatively short period (15–30 months) after disease diagnosis and UDCA treatment. Although our findings show a reduction in anti-BCOADC-E2 titers in some PBC patients during the early stage of UDCA treatment, the mechanisms underlying this immunological change remain unclear. UDCA is known to exert anti-inflammatory and immunomodulatory effects, including improved bile flow and reduced hepatocyte stress, which may indirectly attenuate autoimmune responses. It is possible that these effects contribute to the observed decline in autoantibody titers, though further mechanistic studies are needed.

Although the titer analysis of autoantibodies during UDCA treatment consisted of ten patients, multiple longitudinal samples were collected per individual (3–5 time points each), resulting in a total of approximately 38 samples. This repeated-measures design enabled us to assess within-patient changes over time, providing richer insights into the dynamics of change in titer during UDCA response. Nevertheless, we acknowledge that the limited number of patients restricts generalizability, and the observed trends in antibody changes post-UDCA treatment are preliminary and require confirmation in larger, prospective studies.

The exact role of AMA in the immunopathology and pathogenesis of PBC remains obscure. Some investigators believe that serum AMA is not linked to the progression of PBC, as the AMA titer does not change significantly over the course of the disease15. In our study, we report for the first time that one of the PBC-specific AMA antibodies, BCOADC-E2, showed a significant decrease in antibody titer during the early stage of UDCA treatment. From the limited number of patients studied, we did not find any correlation between the decrease or loss of anti-BCOADC-E2 and changes in specific biochemical indices (data not shown).

In conclusion, PBC-specific AMAs other than anti-PDC-E2 were evaluated for the first time in Chinese PBC cohorts. Higher prevalence of anti-BCOADC-E2 and OGDC-E2 antibodies were observed. A significant correlation between anti-BCOADC-E2 status and initial serum bilirubin concentration of PBC patients was found in Chinese PBC patients. Loss or significant decrease in anti-BCOADC-E2 antibody was found in half of PBC patients after the UDCA treatment. Further studies need to be performed to analyze the clinical significance.

ALB - albumin, ALP - alkaline phosphatase, ALT - alanine aminotransferase, AMA - anti-mitochondrial antibodies, ANA - anti-nuclear antibodies, AST - aspartate aminotransferase, BA - Barcelona criteria, BCOADC - branched chain 2-oxo-acid dehydrogenase complex, DB - direct bilirubin, E2 - enzyme subunit, GGT - gamma-glutamyl transferase, OGDC - 2-oxo-glutaric acid dehydrogenase complex, PA - Paris I criteria, PBC - primary biliary cholangitis, PDC - pyruvate dehydrogenase complex, SD - standard deviation, TB - total bilirubin, TP - total protein, UDCA - ursodeoxycholic acid

We are indebted to the patients with PBC who participated in this study. We thank all participating members of The Jiangsu Provincial PBC Collaboration Group for providing patient samples and clinical information.

Jawed R performed experimental work; Jawed R performed statistical analysis; Jawed R prepared and revised the manuscript.

This work was supported by grants from the National Natural Science Foundation of China (No. 81270295; No. 81770381, Key R&D Program of Jiangsu Province (SBE2017740378), the Natural Science Foundation of Jiangsu Province (No. SBK2015020697), and the Fundamental Research Funds for the Central Universities.

Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.

This study was approved by the ethics committee of southeast university hospital and in accordance with the guidelines of the Declaration of Helsinki. Written informed consent was obtained from each patient prior to screening on the approved informed consent form.

Written informed consent was obtained from the patient’s mother for publication of this Case Report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

The authors declare that they have not used generative AI (a type of artificial intelligence technology that can produce various types of content including text, imagery, audio and synthetic data. Examples include ChatGPT, NovelAI, Jasper AI, Rytr AI, DALL-E, etc) and AI-assisted technologies in the writing process before submission.

The authors declare that they have no competing interests.