<?xml version='1.0' encoding='UTF-8'?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1d1 20130915//EN" "JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta id="journal-meta-1">
      <journal-id journal-id-type="nlm-ta">Biomedical Research and Therapy</journal-id>
      <journal-id journal-id-type="publisher-id">Biomedical Research and Therapy</journal-id>
      <journal-id journal-id-type="journal_submission_guidelines">http://bmrat.org/</journal-id>
      <journal-title-group>
        <journal-title>Biomedical Research and Therapy</journal-title>
      </journal-title-group>
      <issn publication-format="print"/>
    </journal-meta>
    <article-meta id="article-meta-1">
      <article-id pub-id-type="doi">10.15419/bmrat.v11i11.940</article-id>
      <title-group>
        <article-title id="at-ab0b467c076b">Association of <italic id="e-19e98e7f4e33">P73</italic>, <italic id="e-250be067c508">BMP15</italic>, and <italic id="e-844e66a2bf9c">GDF9</italic> gene polymorphisms with diminished ovarian reserve</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-b93327354453">
            <surname>Ghasemifar</surname>
            <given-names>Sina</given-names>
          </name>
          <xref id="x-fab471a5f545" rid="a-c36c184f013a" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-c0f476b31c80">
            <surname>Kalantar</surname>
            <given-names>Seyed Mehdi</given-names>
          </name>
          <xref id="x-1cac8277a2e7" rid="a-c36c184f013a" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-379ce2a53bb3">
            <surname>Babakhanzadeh</surname>
            <given-names>Emad</given-names>
          </name>
          <xref id="x-62f726f60495" rid="a-c36c184f013a" ref-type="aff">1</xref>
          <xref id="x-5962cb07f626" rid="a-71f64d478482" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-46084f00e34d">
            <surname>Mirabutalebi</surname>
            <given-names>Seyed Hamidreza</given-names>
          </name>
          <xref id="x-5c4cbb567e9b" rid="a-c36c184f013a" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-efce15cc586f">
            <surname>Khodadadian</surname>
            <given-names>Ali</given-names>
          </name>
          <xref id="x-38dbba4163f5" rid="a-c36c184f013a" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-e9a43c8f675c">
            <surname>Nazari</surname>
            <given-names>Majid</given-names>
          </name>
          <xref id="x-74e0496ec4c0" rid="a-c36c184f013a" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author" corresp="yes">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-b8f363ca636b">
            <surname>Ghasemi</surname>
            <given-names>Nasrin</given-names>
          </name>
          <email>nghasemi479@gmail.com</email>
          <xref id="x-80e414ce248f" rid="a-c36c184f013a" ref-type="aff">1</xref>
          <xref id="x-4e564b13c0f2" rid="a-8a0548703299" ref-type="aff">3</xref>
        </contrib>
        <aff id="a-c36c184f013a">
          <institution>Department of Medical Genetics, Shahid Sadoughi University of Medical Sciences, Yazd, Iran</institution>
        </aff>
        <aff id="a-71f64d478482">
          <institution>Department of Medical Genetics, Shahid Beheshti University of Medical Sciences, Tehran, Iran</institution>
        </aff>
        <aff id="a-8a0548703299">
          <institution>Abortion Research Center, Yazd Reproductive Sicences Institue, Shahid sadoughi University of Medical Sciences, Yazd, Iran</institution>
        </aff>
      </contrib-group>
      <volume>11</volume>
      <issue>11</issue>
      <fpage>6941</fpage>
      <lpage>6949</lpage>
      <permissions/>
      <abstract id="abstract-8b140cc85881">
        <title id="abstract-title-9d333161ae5f">Abstract</title>
        <p id="paragraph-1489d1a08249"><bold id="s-50a67536408d">Introduction</bold>: Diminished ovarian reserve (DOR) is a condition in which the quantity or quality of oocytes results in impaired fertility. The prevalence of DOR in infertile women is estimated to be around 10%. Our aim was to investigate the polymorphisms rs3810682, rs10491279, and rs4648551 in association with the genes <italic id="e-1ce46fbbb7dd">BMP15</italic>, <italic id="e-737dbc5d0b5d">GDF9</italic>, and <italic id="e-799ee08ebfe0">p73</italic> in patients with DOR and control samples. <bold id="s-1139b283693a">Methods</bold>: Genomic DNA was isolated from 5 cc of peripheral blood from 300 participants (150 patients with DOR and 150 women without a history of DOR). After ARMS-PCR assay and sequencing of a series of samples to confirm results, data were analyzed using GraphPad Prism software. <bold id="s-2384eb323d53">Results</bold>: A significant difference was found between the frequencies of the different polymorphisms associated with the <italic id="e-686b6c4c321e">BMP15</italic> gene (P value = 0.002). However, for the polymorphisms of the <italic id="e-f135ff497410">GDF9</italic> and <italic id="e-ece730952242">p73</italic> genes, no significant difference was found between the frequencies of these polymorphisms in the control and patient groups. <bold id="s-50a0323bf863">Conclusion</bold>: Determining the frequency of gene variants in case and control groups helps in understanding the potential risk factors for the development of DOR. Understanding these factors is very important in different populations that naturally have different lifestyles, especially in a country like Iran, where a large number of pregnancies occur at older ages due to the use of contraceptives. Determining risk factors can help women decide when to become pregnant. Finally, further validation is needed to obtain more information on the use of the polymorphisms investigated in this study as an indicator of DOR in Iranian populations.</p>
      </abstract>
      <kwd-group id="kwd-group-1">
        <title>Keywords</title>
        <kwd>Diminished ovarian reserve</kwd>
        <kwd>BMP15</kwd>
        <kwd>GDF9</kwd>
        <kwd>and p73</kwd>
        <kwd>polymorphism</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec>
      <title id="t-fdce187150fe">Introduction</title>
      <p id="p-fb5d15167db6">Diminished ovarian reserve (DOR) is a condition where the quantity or quality of oocytes leads to abnormal fertility<bold id="s-e1e146b2bf83"><xref id="x-8d1ffb0e79c4" rid="R254494232288410" ref-type="bibr">1</xref></bold>. DOR is clinically characterized by signs such as low levels of anti-Müllerian hormone (AMH) (&lt; 0.5 – 1.1 ng/ml), low antral follicle count (AFC) (5–7 follicles), and elevated levels of follicle-stimulating hormone (FSH) (≥ 10 mIU/ml)<bold id="s-f0ed0ea79273"><xref rid="R254494232288411" ref-type="bibr">2</xref>, <xref rid="R254494232288412" ref-type="bibr">3</xref>, <xref rid="R254494232288413" ref-type="bibr">4</xref>, <xref rid="R254494232288414" ref-type="bibr">5</xref></bold>. Aging is one of the main causes of DOR; smoking, and invasive treatments such as chemotherapy and radiotherapy are other causes. Genetic conditions such as fragile X syndrome, ovarian surgery, endometriosis, and autoimmune diseases are additional examples of causes of DOR<bold id="s-e9acf2f96be5"><xref rid="R254494232288415" ref-type="bibr">6</xref>, <xref rid="R254494232288416" ref-type="bibr">7</xref></bold>. Unfortunately, most women do not exhibit any symptoms of DOR. Only as the condition progresses over time do women notice a shortening of their menstrual cycles.</p>
      <p id="p-11c10ec4adf8">In general, there is no cure to delay or prevent DOR. Reportedly, 33% of patients with DOR are able to become pregnant with their own eggs after treatment<bold id="s-9a6642623a27"><xref rid="R254494232288417" ref-type="bibr">8</xref>, <xref rid="R254494232288418" ref-type="bibr">9</xref></bold>. However, reports emphasize that early diagnosis is important as it increases the chances of conception. In the meantime, the main treatment for DOR is to preserve the ability to conceive by stimulating the ovaries and using assisted reproductive techniques such as IVF<bold id="s-0dc64e0c65c3"><xref rid="R254494232288419" ref-type="bibr">10</xref>, <xref rid="R254494232288420" ref-type="bibr">11</xref></bold>. Another treatment option for women who wish to delay pregnancy is the freezing of eggs and embryos. To treat DOR, medication is administered to stimulate the ovaries to grow eggs, which can then be frozen or used for IVF. Considering the difficulty and complexity of treating diminished ovarian reserve, it seems that studying genetic and epigenetic factors could shed more light on improving our current knowledge in this field.</p>
      <p id="p-904ca80ac291">GDF9 encodes a secreted ligand of the TGF-beta superfamily<bold id="s-1f1a293c117b"><xref rid="R254494232288421" ref-type="bibr">12</xref>, <xref rid="R254494232288422" ref-type="bibr">13</xref></bold>. GDF9 is essential for the development of surrounding somatic cells, particularly granulosa, cumulus, and theca cells<bold id="s-a8deb21dd71b"><xref id="x-22279ee1c5a2" rid="R254494232288423" ref-type="bibr">14</xref></bold>. Paracrine interactions between the developing oocyte and the surrounding follicle cells are crucial for proper follicle and oocyte development. GDF9 is essential for the entire process of follicle maturation, ovulation, and egg maturation and thus plays a central role in female fertility<bold id="s-bb01d42f899d"><xref id="x-4d1ffc1972d9" rid="R254494232288424" ref-type="bibr">15</xref></bold>. GDF9 binds to the receptors for bone morphogenetic protein (BMPR) and ALK5 via two receptors on oocytes. It promotes the secretion of inhibin A, thus enhancing the ability of the follicle to develop from an early growth stage. GDF9 promotes the growth of prenatal follicles by preventing apoptosis of granulosa cells<bold id="s-2a3998a5b692"><xref rid="R254494232288425" ref-type="bibr">16</xref>, <xref rid="R254494232288426" ref-type="bibr">17</xref>, <xref rid="R254494232288427" ref-type="bibr">18</xref></bold>. In preovulatory follicles, GDF9 induces progesterone production by stimulating the prostaglandin EP2 receptor signaling pathway. Bone morphogenetic protein 15 (BMP-15), also part of the TGF-β family, is involved in folliculogenesis and is expressed only after the early stages of oocyte development<bold id="s-ab8019e9da6d"><xref id="x-756520e8834c" rid="R254494232288428" ref-type="bibr">19</xref></bold>. The promotion of ovarian follicle growth and maturation in the early stages of gonadotropin-independent folliculogenesis, the regulation of granulosa cell sensitivity to FSH, and the prevention of granulosa cell apoptosis are important functions of BMP15<bold id="s-6a0a5411a2a7"><xref id="x-a69fe5baa441" rid="R254494232288429" ref-type="bibr">20</xref></bold>. In 2004, Hanrahan and colleagues discovered a mutation in the GDF9 gene that increases ovulation and infertility rates in a manner similar to inactivating mutations in BMP15<bold id="s-534890a6f30d"><xref id="x-c1ca13c0e68f" rid="R254494232288430" ref-type="bibr">21</xref></bold>. In 2006, Morón <italic id="e-1dabe221584d">et al</italic>. analyzed various SNPs in the BMP15 gene in 307 Spanish women treated with rFSH. The results showed a direct correlation between the increased number of follicles and various SNPs in the BMP15 gene in response to rFSH<bold id="s-0ed06364759d"><xref id="x-bdd2d302b418" rid="R254494232288431" ref-type="bibr">22</xref></bold>. In 2016, Mehdizadeh<italic id="e-01501ff1387c"> et al</italic>. investigated the association of rs3810682 of the BMP15 gene with polycystic ovary syndrome (PCOS) in the Iranian population. The results showed that the genotype was heterozygous (CG) in 28% of women with PCOS and homozygous (GG) in 2.8%. In a 2017 paper by Peluso <italic id="e-f8d9082e9a08">et al</italic>., no association was found between the rs3810682 SNP of BMP15 and ovarian stimulation in Brazilian infertile women<bold id="s-caad8e55fd6c"><xref id="x-c2c687a79eaf" rid="R254494232288432" ref-type="bibr">23</xref></bold>.</p>
      <p id="p-69534acafbf6">In 2019, Santos <italic id="e-38a983481c5d">et al.</italic> investigated variants of the GDF9 and BMP15 genes in women with primary ovarian insufficiency (POI) and those with high FSH levels compared to the control group. The results showed that the frequency of CT and TT genotypes in BMP15:c.852C&gt; T (rs17003221) was higher in the POI group than in the control group, whereas the analysis of GDF9 variants showed no significant difference in genotype distribution<bold id="s-3df14fb43c5b"><xref id="x-122f3572a5a7" rid="R254494232288433" ref-type="bibr">24</xref></bold>. In 2021, Meireles <italic id="e-a02ac9899cf9">et al</italic>. conducted a study to investigate the correlation between factors associated with follicular growth and reduced ovarian response in ovaries overstimulated for IVF, such as LHR, GDF9, FSHR, AMHR2, and BMP15 polymorphisms. The results suggest that the polymorphism in the GDF9 gene may be a double-edged sword that can have both a positive (C447T) and a negative effect (398-39 C&gt; G) on ovarian reserve<bold id="s-ad5c7937ee23"><xref id="x-02540130a501" rid="R254494232288434" ref-type="bibr">25</xref></bold>.</p>
      <p id="p-8281d9087a89">P73 is involved in cell cycle control and promotes apoptosis. Mouse models have shown that the <italic id="e-a788b1872706">p73</italic> gene is involved in female infertility<bold id="s-45d4cdc8d4cd"><xref id="x-a12c133f0c0d" rid="R254494232288435" ref-type="bibr">26</xref></bold>. In 2008, Richard Tomasini <italic id="e-fe4677a8c5e2">et al</italic>. reported that the suppression of p73 expression in mice can lead to infertility<bold id="s-db0add36cd9f"><xref id="x-6cc17176d98a" rid="R254494232288436" ref-type="bibr">27</xref></bold>. Their study showed that female mice carrying deletions of exons 2 and 3 of the p73 gene had normal fertility but ovaries with reduced growth capacity and follicle size. In a 2011 study by Feng<italic id="e-373781ddeb95"> et al.</italic> on women undergoing IVF, an association was found between a SNP (rs4648551, A&gt; G) in the p73 gene and infertility. The results showed that infertile women over the age of 35 had the “G” allele<bold id="s-3683edeb6846"><xref id="x-2ebc1afe8473" rid="R254494232288437" ref-type="bibr">28</xref></bold>. In 2015, a study by Vagnini <italic id="e-f594dc851085">et al</italic>. in 605 Brazilian women showed that a polymorphism (rs4648551, A &gt; G) in the p73 gene could be used as a potential marker for DOR<bold id="s-45805c48cbe6"><xref id="x-be010d4d001a" rid="R254494232288438" ref-type="bibr">29</xref></bold>. In the present study, our aim was to investigate the polymorphisms rs3810682, rs10491279, and rs4648551 in relation to the genes <italic id="e-8e218896acd2">BMP15, GDF9,</italic> and <italic id="e-db9333a2dcdb">p73</italic> in patients with DOR.</p>
    </sec>
    <sec>
      <title id="t-90f8346d4c52">Methods </title>
      <p id="p-d6b9e9d1289c">After explaining the general steps of the experiment to the participants (with ethics approval code: IR.SSU.MEDICINE.REC.1398.186), 5 cc of peripheral blood was collected from 300 participants (150 patients with DOR and 150 women without a history of DOR) referred to the Yazd Reproductive Sciences Research Institute between September 15, 2020, and April 11, 2021, and placed in falcons containing 1.8 mg/ml K<sub id="s-cb15d161aa3e">2</sub> EDTA. Inclusion criteria included age under 35 years, normal karyotype, AMH &lt; 2 µg/L, and no history of chemotherapy. Exclusion criteria were age over 35 years, abnormal karyotype (<italic id="e-fcb845cb66c7">e.g</italic>., fragile X syndrome), and AMH &gt; 2 µg/L. The samples were stored at -20 degrees for DNA extraction.</p>
      <sec>
        <title id="t-cd70c483e707">Genomic DNA extraction from whole peripheral blood</title>
        <p id="p-5d56d8a895d7">DNA isolation from peripheral blood was performed using the SimEX kit (Cat.: SBL15-2136) according to the manufacturer’s procedure. The concentration and purification of the DNA were tested with a spectrophotometer (Thermo Scientific, Wilmington, USA) and validated by 1% agarose gel electrophoresis.</p>
      </sec>
      <sec>
        <title id="t-1abfa35fe460">ARMS-PCR</title>
        <p id="p-1163136d47ed">The ARMS-PCR assay was used to specifically amplify the sequences of interest in two tubes. A 100 ng DNA template and Amplicon Master Mix Kit as well as specific primers (<bold id="s-ae76cdcc4558"><xref id="x-5be8229ea177" rid="tw-56b4109ee921" ref-type="table">Table 1</xref></bold>) were used for amplification. The primers contained mismatches to maximize discrimination between wild-type and mutant alleles. The PCR settings were: primary denaturation at 95 °C for 1 minute, 40 cycles of denaturation at 95 °C for 30 seconds, annealing at 60 °C for 45 seconds, and extension at 72 °C for 40 seconds. The last extension was carried out at 72 °C for 10 minutes. The products were loaded onto a 2% agarose gel for 50 minutes at 110 V with a 100 bp ladder and imaged under ultraviolet light after staining with SYBR Safe DNA Gel Stain (Cat. 881603PR).</p>
      </sec>
      <sec>
        <title id="t-d68c70042ff4">Statistical analysis</title>
        <p id="p-3ca2b8abfb5f">Following the ARMS-PCR assay and sequencing of a number of samples to confirm the results, statistical analysis was completed using the one-way ANOVA test followed by Dunnett’s multiple comparison test. P values less than 0.05 were considered statistically significant. Statistical analysis was performed using GraphPad Prism 6 software.</p>
        <p id="p-fb3c608386e4"/>
        <p id="p-aa3831a4e303"/>
        <table-wrap id="tw-56b4109ee921" orientation="portrait">
          <label>Table 1</label>
          <caption id="c-f9eea3ac8fec">
            <title id="t-fe3b00a810cc">
              <bold id="s-6fd1874ef0bb">Sequence of primers used in the study</bold>
            </title>
          </caption>
          <table id="t-868c89646acf" rules="rows">
            <colgroup>
              <col width="13.11"/>
              <col width="60.33999999999999"/>
              <col width="26.55"/>
            </colgroup>
            <tbody id="ts-0e08750ca9bc">
              <tr id="tr-406b4db6fb2a">
                <td id="tc-06deef00fa9e" align="left">
                  <p>
                    <bold>
                      <p id="p-64d092a59e28">Gene </p>
                    </bold>
                  </p>
                </td>
                <td id="tc-80f532fb93d7" align="left">
                  <p>
                    <bold>
                      <p id="p-7a4b330c601c">Primers Sequence (5’-3’) </p>
                    </bold>
                  </p>
                </td>
                <td id="tc-de5f728a5774" align="left">
                  <p>
                    <bold>
                      <p id="p-92860ee51bc7">Product (bp) </p>
                    </bold>
                  </p>
                </td>
              </tr>
              <tr id="tr-e76468241f3b">
                <td id="tc-6bf800b929b0" rowspan="4" align="left">
                  <p id="p-422bbc8f4f99">
                    <italic id="e-bc9a74243260">BMP15 </italic>
                  </p>
                </td>
                <td id="tc-835ab7c6862f" align="left">
                  <p id="p-0c5832b45bbf">F (Ex): AGCCATACTCAGTAGTTTCC</p>
                </td>
                <td id="tc-a1472bb38b9a" rowspan="4" align="center">
                  <p id="p-66c1b85b4ca4">Ex: 661</p>
                  <p id="p-1e8c619ce44f">In: 396 </p>
                </td>
              </tr>
              <tr id="tr-26a587887706">
                <td id="tc-0274863db334" align="left">
                  <p id="p-085e9ccc7117">F (In): TAGGGGCAAGTAGGATCAGG</p>
                </td>
              </tr>
              <tr id="tr-6173b77c061f">
                <td id="tc-2c999e2fdc12" align="left">
                  <p id="p-a29de2eebae3">R (N): AGGAGGACCATCTTGAAAGG</p>
                </td>
              </tr>
              <tr id="table-row-5">
                <td id="tc-8827a86d4173" align="left">
                  <p id="p-598fb3be2afe">R (M): AGGAGGACCATCTTGAAAGC</p>
                </td>
              </tr>
              <tr id="table-row-6">
                <td id="tc-aebc293966a9" rowspan="4" align="left">
                  <p id="p-b248fa23eca8">
                    <italic id="e-71479b2b7a9d">GDF9</italic>
                  </p>
                </td>
                <td id="tc-6c587b901601" align="left">
                  <p id="p-558c6d35e7d1">F (M): AGTCCTGCTAGAAGACTTTGGT</p>
                </td>
                <td id="tc-66e7944d228d" rowspan="4" align="center">
                  <p id="p-6271334e74d6">Ex: 368</p>
                  <p id="p-61f64d1d908e">In: 236 </p>
                </td>
              </tr>
              <tr id="table-row-7">
                <td id="table-cell-13" align="left">
                  <p id="p-aa714070e9ef">F (N): AGTCCTGCTAGAAGACTTTGGC</p>
                </td>
              </tr>
              <tr id="table-row-8">
                <td id="table-cell-14" align="left">
                  <p id="p-1431da6c28ae">R (In): TTGACTTGACTGCCTGTTGTG</p>
                </td>
              </tr>
              <tr id="table-row-9">
                <td id="table-cell-15" align="left">
                  <p id="p-e6be3f483f63">R (Ex): CAGTAAGGTTGCTGGGAATT</p>
                </td>
              </tr>
              <tr id="table-row-10">
                <td id="table-cell-16" rowspan="4" align="left">
                  <p id="p-74e57a703e2a">
                    <italic id="e-b50e61dc69fe">P73</italic>
                  </p>
                </td>
                <td id="table-cell-17" align="left">
                  <p id="p-e1e35ce8b878">F (N): TCCGTCAGGGCTGAGGATCG</p>
                </td>
                <td id="table-cell-18" rowspan="4" align="center">
                  <p id="p-9125992435f0">Ex: 200</p>
                  <p id="p-363b56bbab9f">In: 129 </p>
                </td>
              </tr>
              <tr id="table-row-11">
                <td id="table-cell-19" align="left">
                  <p id="p-2f537c393a0d">F (M): TCCGTCAGGGCTGAGGATCA</p>
                </td>
              </tr>
              <tr id="table-row-12">
                <td id="table-cell-20" align="left">
                  <p id="p-64702477c2c4">R (In): GGAGACAGATGTGTCTGCTGGC</p>
                </td>
              </tr>
              <tr id="table-row-13">
                <td id="table-cell-21" align="left">
                  <p id="p-8d791b95e048">R (Ex): GCCAGTGCCAGGCCCAGCGC</p>
                </td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn-group>
              <fn id="f-ce4e419015ff">
                <p id="p-0a51b03151a6"><bold id="s-fdab1ec6c116">N</bold>: Normal; <bold id="s-29962b803dbe">M</bold>; Mutant; <bold id="s-31b5e9a74b75">Ex</bold>: External; <bold id="s-912e41892ed4">In</bold>: Internal</p>
              </fn>
            </fn-group>
          </table-wrap-foot>
        </table-wrap>
        <p id="p-9b9a25d093f5"/>
        <p id="p-b54d21eccf20"/>
        <fig id="f-38180d24009c" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 1 </label>
          <caption id="c-90193c0a4faf">
            <title id="t-ad26e426ec37"><bold id="s-5914f1c680b3">ARMS-PCR gel electrophoresis of <italic id="e-a6761899b01d">BMP15, GDF9</italic> and <italic id="e-f69186a77059">p73</italic> genes</bold>. Each pair of lanes is for a single sample. </title>
            <p id="p-3d053f79fb16"><bold id="s-f26cf2db4029">Abbreviations</bold>: <bold id="s-c462da993927">R-N</bold>: Normalreverse; <bold id="s-88e1bd9daf95">R-M</bold>: Mutated reverse</p>
          </caption>
          <graphic id="g-a08a58671fac" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/1ba57d11-005d-4d32-b8dc-d682e6445041/image/ec644361-65ab-4739-94f8-bbb81bbc9888-uimage.png"/>
        </fig>
        <p id="p-a3526a527606"/>
        <p id="p-3f176e63f3d3"/>
        <fig id="f-6897aa7fc86f" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 2 </label>
          <caption id="c-e488a7205c9c">
            <title id="t-aa9d4838bde9"><bold id="s-9166a104bf93">Sequencing results of a homozygous and heterozygous sample for <italic id="e-502f833a9f47">BMP15</italic>, <italic id="e-7d1e488e5cfc">GDF9</italic> and <italic id="e-cb832e512441">p73</italic> gene</bold>.</title>
          </caption>
          <graphic id="g-a8442dd14eb3" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/1ba57d11-005d-4d32-b8dc-d682e6445041/image/dd4b96d7-0b9d-498c-92ca-c17a221b2e04-uimage.png"/>
        </fig>
        <p id="p-37bcb524bfb6"/>
        <p id="p-e8571ba8fe23"/>
      </sec>
    </sec>
    <sec>
      <title id="t-2d6d25ab7bda">Results</title>
      <p id="p-e168f527272e">After sampling, DNA extraction, and preparation of the PCR reaction, genotyping of samples for the <italic id="e-81900f960f7d">BMP15, GDF9</italic>, and <italic id="e-93efe91845b8">p73</italic> genes was performed by ARMS-PCR in two tubes, and several samples were sequenced to confirm the results.</p>
      <sec>
        <title id="t-eeb05b84ec29">
          <bold id="strong-1">BMP15 Gene Genotyping</bold>
        </title>
        <p id="p-66d3516bb00a">The ARMS-PCR reaction was performed for all samples, and the results were observed and analyzed on agarose gel (2%). With respect to the rs3810682 polymorphism of <italic id="e-897551eecb4e">BMP15</italic>, the primers were designed so that the length of the PCR product of the external control primer was 661 bp and the length of the internal primer (indicating the presence or absence of the polymorphism) was 396 bp. The results of the rs3810682 polymorphism gel electrophoresis are shown in <bold id="s-d1ef2adcde3b"><xref id="x-6cee465b549a" rid="f-38180d24009c" ref-type="fig">Figure 1</xref></bold> <bold id="s-f97b64af6a1f">A</bold>. This shows that in the first lane of each sample, the external control primer (product length = 661 bp) was used with the normal primer (acting with the wild-type nucleotide "C" in the samples), and in the second lane, the external control primer was used with the mutation-specific primer (G nucleotide). Therefore, 6 wells (3 samples) belonged to samples that were normally homozygous (C nucleotide), as only the lanes with the normal primer (product length = 396 bp) were used. The next four lanes (2 samples) belonged to heterozygous samples, as both normal and mutant-specific primers resulted in a PCR product. The next four wells also belonged to mutant homozygous samples. The last two wells were negative control samples for normal and mutant-specific primers. In the next step (to confirm the gel electrophoresis results), a series of samples were sequenced, and the sequencing result of this polymorphism is also shown in <bold id="s-feaf93631d72"><xref id="x-f1c3e94f1266" rid="f-6897aa7fc86f" ref-type="fig">Figure 2</xref>A</bold> and <bold id="s-c2684ee4398b">B</bold>.</p>
      </sec>
      <sec>
        <title id="t-32ac4a04dc3b">
          <bold id="strong-2">GDF9 Gene Genotyping</bold>
        </title>
        <p id="p-1e9f29256d96">For the rs10491279 polymorphism of GDF9, the primers were designed so that the PCR product length of the external control primer was 368 bp, and the length of the internal primer (indicating the presence or absence of the polymorphism) was 236 bp. The gel electrophoresis results of the rs10491279 polymorphism are shown in <bold id="s-65394d3acd7b"><xref id="x-1529155177de" rid="f-38180d24009c" ref-type="fig">Figure 1</xref></bold><bold id="s-278a689266f2">B</bold>, where the external control primer (product length = 368 bp) with the normal primer (acting with the wild-type nucleotide "C" in the samples) was used in the first lane of each sample, and the external control primer with the mutation-specific primer (nucleotide G) was used in the second lane. Consequently, 6 wells (3 samples) belonged to samples that were normally homozygous (C nucleotide), as only the lanes were linked to the normal primer (product length = 236 bp). The next four lanes (2 samples) belonged to heterozygous samples, as both normal and mutant-specific primers resulted in a PCR product. The next four wells also belonged to mutant homozygous samples. The last two wells were negative control samples for normal and mutant-specific primers. In the next step (to confirm the gel electrophoresis results), a series of samples were sequenced, and the sequencing result of this polymorphism is also shown in <bold id="s-299d6db261db"><xref id="x-8eaf6933c390" rid="f-6897aa7fc86f" ref-type="fig">Figure 2</xref>C</bold> and <bold id="s-7496756e7c5e">D</bold>.</p>
      </sec>
      <sec>
        <title id="t-80c281eb24ea">
          <bold id="strong-3">p73 Gene Genotyping</bold>
        </title>
        <p id="p-5c8ede25d5c4">For the rs4648551 polymorphism associated with the <italic id="e-7954b3dbab01">p73</italic> gene, the primers were designed so that the PCR product length of the external control primer was 200 bp, and the length of the internal primer (indicating the presence or absence of the polymorphism) was 129 bp. The gel electrophoresis results of the rs4648551 polymorphism are shown in <bold id="s-bfccc142bf99"><xref id="x-59d0b275bd2d" rid="f-38180d24009c" ref-type="fig">Figure 1</xref>C</bold>. In the first lane of each sample, the external control primer (product length: 200 bp) was used with the normal primer (acting with the wild-type nucleotide "G" in the samples), and in the second lane, the external control primer was used with the mutation-specific primer (A nucleotide). Thus, 4 wells (2 samples) belonged to samples that were normally heterozygous, as both normal and mutation-specific primers resulted in a PCR product. Similarly, the next 6 lanes (3 samples) belonged to normal homozygotes (G nucleotide), as only the lanes with the normal primer (product length: 129 bp) were used. The next four wells also belonged to the mutant homozygous specimens. The last two wells were negative control samples for normal and mutant-specific primers. In the next step (to confirm the gel electrophoresis results), a series of samples were sequenced, and the sequencing result of this polymorphism is also shown in <bold id="s-734241ac282b"><xref id="x-c26f1fb91fc0" rid="f-6897aa7fc86f" ref-type="fig">Figure 2</xref>E</bold> and <bold id="s-79baf016b736">F</bold>.</p>
        <p id="p-19702c40aa1c"/>
      </sec>
    </sec>
    <sec>
      <title id="t-a9c0e67e1aa6">
        <bold id="s-ff67605432d8">Discussion</bold>
      </title>
      <p id="p-79d85c4081a6">The reason for DOR could be attributed to many genetic changes and is still under investigation. According to Olsen <italic id="e-3aeab298279f">et al</italic>., various causes of DOR could lead to a reduced follicle number or a defect in the follicle-stimulating mechanisms. Regarding the rs3810682 polymorphism in BMP15, the results of the present experiment were not consistent with the results reported in some other studies, including the study by Gonzalez <italic id="e-6defaea0cd40">et al</italic>. and the study by Sproul <italic id="e-3a556fc6e7ac">et al</italic>.; however, it should be noted that both studies were performed in patients with polycystic ovary syndrome<bold id="s-8b1a2d964838"><xref rid="R254494232288439" ref-type="bibr">30</xref>, <xref rid="R254494232288440" ref-type="bibr">31</xref></bold>. In contrast, the study by Moron <italic id="e-7e02355f0734">et al. </italic>found a statistically significant association between the high response to ovarian stimulation and BMP15 polymorphism (rs3810682), confirming the results of the present study. Decreased BMP15 levels or activity in the ovary may lead to increased FSHR expression in the granulosa cells, which could result in ovarian hyperstimulation syndrome (OHSS)<bold id="s-558f12134e89"><xref id="x-8610293a995d" rid="R254494232288441" ref-type="bibr">32</xref></bold>. In a study, Fonseca <italic id="e-100141fa1db8">et al</italic>. showed that the rs3810682 in BMP15 increases the incidence of premature ovarian failure, which is due to the large number of follicles that are utilized during a woman's lifetime. A study using transgenic mice overexpressing the <italic id="e-aa0fa36cc064">Bmp15</italic> gene showed that wild-type and transgenic mice produced the same number of primary follicles, but immature transgenic mice had more atretic follicles than wild-type mice<bold id="s-2b728b3fb335"><xref id="x-07eacb6526cc" rid="R254494232288442" ref-type="bibr">33</xref></bold>. In general, in mice with transgenic <italic id="e-9c1f0f78aa31">Bmp15</italic> expression, follicle growth was greater, atresia increased, and FSHR mRNA levels decreased<bold id="s-c25ea09035e7"><xref id="x-6513ee35d447" rid="R254494232288443" ref-type="bibr">34</xref></bold>. This indicates that BMP15 increases follicle growth but not follicle maturation, which ultimately has a negative effect on ovarian reserve<bold id="s-30bf49c2a2c6"><xref id="x-ce031db53e3e" rid="R254494232288444" ref-type="bibr">35</xref></bold>.</p>
      <p id="p-3d787fae6673">The study by Hanevik <italic id="e-7ae540f88975">et al.</italic> found a positive correlation between rs3810682 and OHSS<bold id="s-5a73b88948a5"><xref id="x-c0dde66d3350" rid="R254494232288445" ref-type="bibr">36</xref></bold>. In the present study, an inverse relationship was observed between AMH levels and the rs3810682 polymorphism; AMH levels were lower in homozygous individuals than in normal individuals. This finding contradicted the results of the study by Peluso <italic id="e-507b0b3b5617">et al</italic>. In the results of the study by Peluso <italic id="e-92126b5112f7">et al</italic>., it was reported that AMH levels were higher in patients with the rs3810682 polymorphism than in normal individuals<bold id="s-b673a690d9c7"><xref id="x-89bba2caeaf2" rid="R254494232288432" ref-type="bibr">23</xref></bold>. In general, polymorphisms of the <italic id="e-ce8eda49daa3">BMP15 </italic>gene, especially those occurring in the promoter region, can have a significant impact on gene expression and gene function. In our study, only one of the best-known BMP15-related polymorphisms was investigated, and since BMP15 also contains other important polymorphisms, we cannot assess the effects of the entire BMP15 on infertility based on the information obtained in this study.</p>
      <p id="p-084ec60b041d">In this work, we investigated the rs3810682 polymorphism of <italic id="e-f5a63e803cda">BMP15</italic>, the rs10491279 polymorphism of <italic id="e-c4d5831c6349">GDF9</italic>, and the rs4648551 polymorphism of <italic id="e-ad2907a0e4b9">P73</italic> in women with DOR and normal women. Individuals with elevated FSH levels and decreased AMH levels are potential candidates for DOR. The results of the DOR group were compared with the results of the control group to represent potential risk factors for DOR in the study population and to identify women at higher risk. Galloway <italic id="e-e8d1e57d9c06">et al</italic>. conducted a study in sheep with mutations in <italic id="e-9bd6fe85335d">BMP15</italic>. In this study, a significant increase in ovulation and the birth rate of twins and triplets was observed in heterozygous models. In addition, there was ovarian failure in homozygous sheep, which could be due to incomplete follicular growth. In data from previous studies, Dixit <italic id="e-b200d0fdaf2d">et al</italic>. have shown that the three variants c.-9C&gt; G, c.308A&gt; G, and c.852C&gt; T of BMP15 are associated with DOR<bold id="s-0b52f2679ee5"><xref id="x-2c8755b334ae" rid="R254494232288446" ref-type="bibr">37</xref></bold>. In the case of the c.-9C&gt; G polymorphism, Leidig <italic id="e-777206d61766">et al</italic>. found no correlation between this polymorphism and DOR<bold id="s-249b59c4c4f1"><xref id="x-fa2b5f3be388" rid="R254494232288447" ref-type="bibr">38</xref></bold>. Ma <italic id="e-584f11c3258f">et al.</italic> also found that the frequency of the C allele varied in the case group, and Dixit <italic id="e-9a442d501193">et al.</italic> also confirmed the association between this polymorphism and ovarian failure<bold id="s-f0379176ea3f"><xref id="x-e997b559ac3e" rid="R254494232288448" ref-type="bibr">39</xref></bold>. In the current study, analysis of BMP15 genotypes and alleles showed that CT and TT genotypes for BMP15: c.852 C&gt; T were higher in the patient groups than in the control groups.</p>
      <p id="p-4aa47073a7d2">In this study, no significant difference in the frequency of the rs10491279 polymorphism was found between patients and the control group with respect to GDF9. Furthermore, no association between the polymorphism studied and DOR was found in previous studies. In 2011, Chand <italic id="e-1e888271afbd">et al</italic>. conducted a study on 3616 individuals with normal menopause to investigate the association between 23 single nucleotide changes in five genes—<italic id="e-ef92e8465acd">AMH, AMHR2, BMP15, FOXL2</italic>, and <italic id="e-e6e07dd76869">GDF9</italic>—and menopause and evaluated rs3897937 in <italic id="e-33691b8b29d3">BMP15</italic>, the rs3810682 polymorphism being similar to our study<bold id="s-116966bfdb02"><xref id="x-628228659e79" rid="R254494232288449" ref-type="bibr">40</xref></bold>. In addition, they calculated six different polymorphisms related to GDF9, including rs10491279, rs30177, rs803224, rs11748063, and rs4705974, with the rs10491279 polymorphism being similar to the present study. This research team's analysis also showed no significant association between GDF9 changes and age at menopause, but rs6521896 in <italic id="e-0eafacf96efa">BMP15</italic> was associated with late menopause.</p>
      <p id="p-043a7b098af7">Members of the p53 family are involved in many vital processes that contribute to the regulation of the cell cycle and apoptosis in response to DNA damage<bold id="s-838a92b64ec4"><xref id="x-363a5977e63c" rid="R254494232288450" ref-type="bibr">41</xref></bold>. In addition, the p53 family has been defined as a regulatory factor for vital processes related to human reproduction<bold id="s-4032c745f3e6"><xref id="x-92f1ef202704" rid="R254494232288451" ref-type="bibr">42</xref></bold>. Interpretations have shown that p73 plays an important role in maintaining follicle pool size and ovulation rate, as well as at checkpoints, and influences egg quality. Recent experiments have shown that numerous polymorphisms in this gene may play an essential role in human reproduction. In the current study, the association between the rs4648551 polymorphism and ovarian reserve in Iranian women with DOR was investigated. Since the <italic id="e-3ac04a610b23">p73</italic> gene is related to fertility, small changes in its function could lead to individual changes in ovarian reserve and could be potential targets for reproductive diseases. However, little is known about how this polymorphism acts in female fertility. Our results showed no significant association between DOR and different genotypes of the rs4648551 polymorphism related to the <italic id="e-d25ddde82973">p73 </italic>gene. A study conducted by Feng <italic id="e-c94c7064bb09">et al.</italic> investigated the association between this polymorphism and infertile patients aged 35 years, and the results indicated a significant association between infertility and polymorphism. Tomasini <italic id="e-3832eea5e8b5">et al</italic>. had previously demonstrated a link between this gene and the number of follicles in mice. In contrast to the two studies mentioned, the present study shows that the rs4648551 polymorphism is not significantly associated with the DOR pattern.</p>
      <p id="p-1a94773051c6">Comprehensive genomic sequencing and GWAS studies can reveal several variations associated with DOR. Understanding these factors is essential in different populations that naturally have different lifestyles, and especially in a country like Iran where a large number of pregnancies occur at older ages due to contraceptive use. Determining risk factors can help women decide whether to become pregnant. Finally, further validation is needed to obtain more information on the use of the polymorphisms investigated in this study as an indicator of DOR in Iranian populations.</p>
    </sec>
    <sec>
      <title id="t-9594e3da1024">
        <bold id="s-aa7efc808443">Conclusion </bold>
      </title>
      <p id="p-9ecd1ef2ab3b">One of the limitations of this work is the small number of samples, which led to difficulties in the selection of cases and controls. Another limitation was the reason and method for selecting the polymorphisms of each gene, which must be such that both an innovative aspect is present and sufficient information about it was available in previous studies. The difference between the results of the current survey and the results of the different populations indicates the different ethnic composition of the Iranian population, especially the population in the Yazd urban area. There are large inter-ethnic and indigenous differences in Iran. Therefore, caution should be exercised when using international models to assign risk factors. One of the limitations of the present experiment is the number of participants, which may be increased regardless of the larger population in other demographic studies, and more informative studies may confirm the results reported in the present study with greater certainty. It is possible that other changes in the genes examined are associated with DOR but were not examined in the present study.</p>
    </sec>
    <sec>
      <title id="t-01bd025fac3c">
        <bold id="s-f5fd584aaf16">Abbreviations</bold>
      </title>
      <p id="p-67b69a4fcd53"><bold id="s-c1e714208d6b">AFC</bold>: Antral Follicle Count, <bold id="s-b0662f902b4c">AMH</bold>: Anti-Müllerian Hormone, <bold id="s-412620d78066">AMHR2</bold>: Anti-Müllerian Hormone Receptor Type 2, <bold id="strong-4">ARMS</bold>: Amplification Refractory Mutation System, <bold id="strong-5">BMP15</bold>: Bone Morphogenetic Protein 15, <bold id="strong-6">DOR</bold>: Diminished Ovarian Reserve, <bold id="strong-7">FSH</bold>: Follicle-Stimulating Hormone, <bold id="strong-8">FSHR</bold>: Follicle-Stimulating Hormone Receptor, <bold id="strong-9">GDF9</bold>: Growth Differentiation Factor 9, <bold id="strong-10">GWAS</bold>: Genome-Wide Association Studies, <bold id="strong-11">IVF</bold>: In Vitro Fertilization, <bold id="strong-12">LHR</bold>: Luteinizing Hormone Receptor, <bold id="strong-13">OHSS</bold>: Ovarian Hyperstimulation Syndrome, <bold id="strong-14">PCR</bold>: Polymerase Chain Reaction, <bold id="strong-15">POI</bold>: Primary Ovarian Insufficiency, <bold id="strong-16">P73</bold>: p73 gene, <bold id="strong-17">RS</bold>: RefSeq (e.g., rs3810682), <bold id="strong-18">SNP</bold>: Single Nucleotide Polymorphism,<bold id="strong-19">TGF-β</bold>: Transforming Growth Factor Beta</p>
    </sec>
    <sec>
      <title id="t-5b7ea7c7f75c">Acknowledgments </title>
      <p id="p-df6a397cb4a0">The authors thank all those who participated to this experiment.</p>
    </sec>
    <sec>
      <title id="t-e9a9f98dcfe6">Author’s contributions</title>
      <p id="p-a7a00e07a657">S.G, A.K and E.B performing the main steps of essay, writing the manuscript and statistical tests. S.K, S.M and M.N Collecting the samples and helping to perform DNA extraction and ARMS technique. N.G. Head of team and monitoring and fixing technical errors during all steps of the study. The authors read and approved the final manuscript.</p>
    </sec>
    <sec>
      <title id="t-4fc6b4d0298d">Funding</title>
      <p id="p-a87c9b4bdb2e">None.</p>
    </sec>
    <sec>
      <title id="t-a8963adc2124">Availability of data and materials</title>
      <p id="p-ba3890d2a59d">Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.</p>
    </sec>
    <sec>
      <title id="t-5989ee074ea5">Ethics approval and consent to participate</title>
      <p id="p-d7409ab4f469">Ethics approval code: IR.SSU.MEDICINE.REC.1398.186.</p>
    </sec>
    <sec>
      <title id="t-d7349d9af3b3">Consent for publication</title>
      <p id="p-ad62325b72aa">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-1b547cbdae97">Competing interests</title>
      <p id="p-466026d06da0">The authors declare that they have no competing interests.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="R254494232288410">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Busnelli</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Somigliana</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Cirillo</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Levi-Setti</surname>
              <given-names>P.E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Is diminished ovarian reserve a risk factor for miscarriage? Results of a systematic review and meta-analysis</article-title>
          <source>Human Reproduction Update</source>
          <year>2021</year>
          <volume>27</volume>
          <issue>6</issue>
          <fpage>973</fpage>
          <lpage>88</lpage>
          <issn>1460-2369</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/humupd/dmab018</pub-id>
          <pub-id pub-id-type="pmid">34254138</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288411">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fàbregues</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Ferreri</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Méndez</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Calafell</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Otero</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Farré</surname>
              <given-names>R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>In vitro follicular activation and stem cell therapy as a novel treatment strategies in diminished ovarian reserve and primary ovarian insufficiency</article-title>
          <source>Frontiers in Endocrinology (Lausanne)</source>
          <year>2021</year>
          <volume>11</volume>
          <fpage>617704</fpage>
          <issn>1664-2392</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fendo.2020.617704</pub-id>
          <pub-id pub-id-type="pmid">33716954</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288412">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Huang</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Tang</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Ren</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Jiang</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>X.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Long-term treatment of Nicotinamide mononucleotide improved age-related diminished ovary reserve through enhancing the mitophagy level of granulosa cells in mice</article-title>
          <source>The Journal of Nutritional Biochemistry</source>
          <year>2022</year>
          <volume>101</volume>
          <fpage>108911</fpage>
          <issn>1873-4847</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jnutbio.2021.108911</pub-id>
          <pub-id pub-id-type="pmid">34801690</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288413">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Olsen</surname>
              <given-names>K.W.</given-names>
            </name>
            <name>
              <surname>Castillo-Fernandez</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Chan</surname>
              <given-names>A.C.</given-names>
            </name>
            <name>
              <surname>la Cour Freiesleben</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Zedeler</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Bungum</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Identification of a unique epigenetic profile in women with diminished ovarian reserve</article-title>
          <source>Fertility and Sterility</source>
          <year>2021</year>
          <volume>115</volume>
          <issue>3</issue>
          <fpage>732</fpage>
          <lpage>41</lpage>
          <issn>1556-5653</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.fertnstert.2020.09.009</pub-id>
          <pub-id pub-id-type="pmid">33272626</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288414">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jahangir</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Nazari</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Babakhanzadeh</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Manshadi</surname>
              <given-names>S.D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Where do obesity and male infertility collide?</article-title>
          <source>BMC Medical Genomics</source>
          <year>2024</year>
          <volume>17</volume>
          <issue>1</issue>
          <fpage>128</fpage>
          <issn>1755-8794</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s12920-024-01897-5</pub-id>
          <pub-id pub-id-type="pmid">38730451</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288415">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hoseini</surname>
              <given-names>S.H.</given-names>
            </name>
            <name>
              <surname>Enayati</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Nazari</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Babakhanzadeh</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Rastgoo</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Sohrabi</surname>
              <given-names>N.B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Biomarker Profile of Colorectal Cancer: Current Findings and Future Perspective</article-title>
          <source>Journal of Gastrointestinal Cancer</source>
          <year>2024</year>
          <volume>55</volume>
          <issue>2</issue>
          <fpage>497</fpage>
          <lpage>510</lpage>
          <issn>1941-6636</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s12029-023-00990-9</pub-id>
          <pub-id pub-id-type="pmid">38168859</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288416">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Alipourfard</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Khorshidian</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Babakhanzadeh</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Nazari</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Susceptibility to azoospermia by haplotype analysis of protamine 1 and protamine 2 variants</article-title>
          <source>Human Gene</source>
          <year>2023</year>
          <volume>37</volume>
          <fpage>201200</fpage>
          <issn>2773-0441</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.humgen.2023.201200</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288417">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fan</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Chang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Wei</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Goldsmith</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Apoptosis of mural granulosa cells is increased in women with diminished ovarian reserve</article-title>
          <source>Journal of Assisted Reproduction and Genetics</source>
          <year>2019</year>
          <volume>36</volume>
          <issue>6</issue>
          <fpage>1225</fpage>
          <lpage>35</lpage>
          <issn>1573-7330</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s10815-019-01446-5</pub-id>
          <pub-id pub-id-type="pmid">30980221</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288418">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nazari</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Khorshidian</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Alizadeh</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Falahati</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Haghparast</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Ghasemifar</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Association between peroxisome proliferator activated receptor gamma coactivator 1 gene with overweight and obesity risk: case\textendashcontrol study and meta-analysis</article-title>
          <source>Human Gene</source>
          <year>2022</year>
          <volume>34</volume>
          <fpage>201123</fpage>
          <issn>2773-0441</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.humgen.2022.201123</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288419">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Qin</surname>
              <given-names>J.C.</given-names>
            </name>
            <name>
              <surname>Fan</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Qin</surname>
              <given-names>A.P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The effect of dehydroepiandrosterone (DHEA) supplementation on women with diminished ovarian reserve (DOR) in IVF cycle: evidence from a meta-analysis</article-title>
          <source>Journal of Gynecology Obstetrics and Human Reproduction</source>
          <year>2017</year>
          <volume>46</volume>
          <issue>1</issue>
          <fpage>1</fpage>
          <lpage>7</lpage>
          <issn>2468-7847</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.jgyn.2016.01.002</pub-id>
          <pub-id pub-id-type="pmid">28403950</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288420">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Babakhanzadeh</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Danaei</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Abedinzadeh</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Ashrafzadeh</surname>
              <given-names>H.R.</given-names>
            </name>
            <name>
              <surname>Ghasemi</surname>
              <given-names>N.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Association of miR-146a and miR196a2 genotype with susceptibility to idiopathic recurrent pregnancy loss in Iranian women: A case-control study</article-title>
          <source>International Journal of Reproductive Biomedicine</source>
          <year>2021</year>
          <volume>19</volume>
          <issue>8</issue>
          <fpage>725</fpage>
          <lpage>32</lpage>
          <issn>2476-4108</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.18502/ijrm.v19i8.9620</pub-id>
          <pub-id pub-id-type="pmid">34568733</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288421">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Belli</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Shimasaki</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Molecular aspects and clinical relevance of GDF9 and BMP15 in ovarian function</article-title>
          <source>Vitamins and Hormones</source>
          <year>2018</year>
          <volume>107</volume>
          <fpage>317</fpage>
          <lpage>48</lpage>
          <issn>0083-6729</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/bs.vh.2017.12.003</pub-id>
          <pub-id pub-id-type="pmid">29544636</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288422">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Khodadadian</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Varghaiyan</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Babakhanzadeh</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Alipourfard</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Haghi-Daredeh</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ghobadi</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Fertility preservation in women with ovarian cancer: Finding new pathways: A case-control study</article-title>
          <source>International Journal of Reproductive Biomedicine</source>
          <year>2021</year>
          <volume>19</volume>
          <issue>2</issue>
          <fpage>157</fpage>
          <lpage>66</lpage>
          <issn>2476-4108</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.18502/ijrm.v19i2.8474</pub-id>
          <pub-id pub-id-type="pmid">33718760</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288423">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>M.N.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>T.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The role of BMP15 and GDF9 in the pathogenesis of primary ovarian insufficiency</article-title>
          <source>Human Fertility (Cambridge, England)</source>
          <year>2021</year>
          <volume>24</volume>
          <issue>5</issue>
          <fpage>325</fpage>
          <lpage>32</lpage>
          <issn>1742-8149</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/14647273.2019.1672107</pub-id>
          <pub-id pub-id-type="pmid">31607184</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288424">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Alam</surname>
              <given-names>M.H.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Miyano</surname>
              <given-names>T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>GDF9 and BMP15 induce development of antrum-like structures by bovine granulosa cells without oocytes</article-title>
          <source>The Journal of Reproduction and Development</source>
          <year>2018</year>
          <volume>64</volume>
          <issue>5</issue>
          <fpage>423</fpage>
          <lpage>31</lpage>
          <issn>1348-4400</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1262/jrd.2018-078</pub-id>
          <pub-id pub-id-type="pmid">30033985</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288425">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mottershead</surname>
              <given-names>D.G.</given-names>
            </name>
            <name>
              <surname>Sugimura</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Al-Musawi</surname>
              <given-names>S.L.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>J.J.</given-names>
            </name>
            <name>
              <surname>Richani</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>White</surname>
              <given-names>M.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Cumulin, an oocyte-secreted heterodimer of the transforming growth factor-β family, is a potent activator of granulosa cells and improves oocyte quality</article-title>
          <source>The Journal of Biological Chemistry</source>
          <year>2015</year>
          <volume>290</volume>
          <issue>39</issue>
          <fpage>24007</fpage>
          <lpage>20</lpage>
          <issn>1083-351X</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1074/jbc.M115.671487</pub-id>
          <pub-id pub-id-type="pmid">26254468</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288426">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Heath</surname>
              <given-names>D.A.</given-names>
            </name>
            <name>
              <surname>Pitman</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>McNatty</surname>
              <given-names>K.P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Molecular forms of ruminant BMP15 and GDF9 and putative interactions with receptors</article-title>
          <source>Reproduction (Cambridge, England)</source>
          <year>2017</year>
          <volume>154</volume>
          <issue>4</issue>
          <fpage>521</fpage>
          <lpage>34</lpage>
          <issn>1741-7899</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1530/REP-17-0188</pub-id>
          <pub-id pub-id-type="pmid">28733348</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288427">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nazari</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Babakhanzadeh</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Mohsen Aghaei Zarch</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Talebi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Narimani</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Dargahi</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Upregulation of the RNF8 gene can predict the presence of sperm in azoospermic individuals</article-title>
          <source>Clinical and Experimental Reproductive Medicine</source>
          <year>2020</year>
          <volume>47</volume>
          <issue>1</issue>
          <fpage>61</fpage>
          <lpage>7</lpage>
          <issn>2233-8233</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.5653/cerm.2019.03111</pub-id>
          <pub-id pub-id-type="pmid">32146775</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288428">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Otsuka</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>McTavish</surname>
              <given-names>K.J.</given-names>
            </name>
            <name>
              <surname>Shimasaki</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Integral role of GDF-9 and BMP-15 in ovarian function</article-title>
          <source>Molecular Reproduction and Development</source>
          <year>2011</year>
          <volume>78</volume>
          <issue>1</issue>
          <fpage>9</fpage>
          <lpage>21</lpage>
          <issn>1098-2795</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/mrd.21265</pub-id>
          <pub-id pub-id-type="pmid">21226076</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288429">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Moore</surname>
              <given-names>R.K.</given-names>
            </name>
            <name>
              <surname>Shimasaki</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Molecular biology and physiological role of the oocyte factor, BMP-15</article-title>
          <source>Molecular and Cellular Endocrinology</source>
          <year>2005</year>
          <volume>234</volume>
          <issue>1-2</issue>
          <fpage>67</fpage>
          <lpage>73</lpage>
          <issn>0303-7207</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.mce.2004.10.012</pub-id>
          <pub-id pub-id-type="pmid">15836954</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288430">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hanrahan</surname>
              <given-names>J.P.</given-names>
            </name>
            <name>
              <surname>Gregan</surname>
              <given-names>S.M.</given-names>
            </name>
            <name>
              <surname>Mulsant</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Mullen</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Davis</surname>
              <given-names>G.H.</given-names>
            </name>
            <name>
              <surname>Powell</surname>
              <given-names>R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries)</article-title>
          <source>Biology of Reproduction</source>
          <year>2004</year>
          <volume>70</volume>
          <issue>4</issue>
          <fpage>900</fpage>
          <lpage>9</lpage>
          <issn>0006-3363</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1095/biolreprod.103.023093</pub-id>
          <pub-id pub-id-type="pmid">14627550</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288431">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Morón</surname>
              <given-names>F.J.</given-names>
            </name>
            <name>
              <surname>de Castro</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Royo</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>Montoro</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Mira</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Sáez</surname>
              <given-names>M.E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Bone morphogenetic protein 15 (BMP15) alleles predict over-response to recombinant follicle stimulation hormone and iatrogenic ovarian hyperstimulation syndrome (OHSS)</article-title>
          <source>Pharmacogenetics and Genomics</source>
          <year>2006</year>
          <volume>16</volume>
          <issue>7</issue>
          <fpage>485</fpage>
          <lpage>95</lpage>
          <issn>1744-6872</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1097/01.fpc.0000215073.44589.96</pub-id>
          <pub-id pub-id-type="pmid">16788381</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288432">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Peluso</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Goldman</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Cavalcanti</surname>
              <given-names>V.</given-names>
            </name>
            <name>
              <surname>Gastaldo</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Trevisan</surname>
              <given-names>C.M.</given-names>
            </name>
            <name>
              <surname>Christofolini</surname>
              <given-names>D.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Use of bone morphogenetic protein 15 polymorphisms to predict ovarian stimulation outcomes in infertile Brazilian women</article-title>
          <source>Genetic Testing and Molecular Biomarkers</source>
          <year>2017</year>
          <volume>21</volume>
          <issue>5</issue>
          <fpage>328</fpage>
          <lpage>33</lpage>
          <issn>1945-0257</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1089/gtmb.2016.0074</pub-id>
          <pub-id pub-id-type="pmid">28410456</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288433">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Santos</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Cordts</surname>
              <given-names>E.B.</given-names>
            </name>
            <name>
              <surname>Peluso</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Dornas</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Neto</surname>
              <given-names>F.H.</given-names>
            </name>
            <name>
              <surname>Bianco</surname>
              <given-names>B.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Association of BMP15 and GDF9 variants to premature ovarian insufficiency</article-title>
          <source>Journal of Assisted Reproduction and Genetics</source>
          <year>2019</year>
          <volume>36</volume>
          <issue>10</issue>
          <fpage>2163</fpage>
          <lpage>9</lpage>
          <issn>1573-7330</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s10815-019-01548-0</pub-id>
          <pub-id pub-id-type="pmid">31392662</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288434">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Meireles</surname>
              <given-names>A.J.</given-names>
            </name>
            <name>
              <surname>Bilibio</surname>
              <given-names>J.P.</given-names>
            </name>
            <name>
              <surname>Lorenzzoni</surname>
              <given-names>P.L.</given-names>
            </name>
            <name>
              <surname>Conto</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Nascimento</surname>
              <given-names>F.C.</given-names>
            </name>
            <name>
              <surname>Cunha-Filho</surname>
              <given-names>J.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Association of FSHR, LH, LHR, BMP15, GDF9, AMH, and AMHR polymorphisms with poor ovarian response in patients undergoing in vitro fertilization</article-title>
          <source>JBRA Assisted Reproduction</source>
          <year>2021</year>
          <volume>25</volume>
          <issue>3</issue>
          <fpage>439</fpage>
          <lpage>46</lpage>
          <issn>1518-0557</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.5935/1518-0557.20210004</pub-id>
          <pub-id pub-id-type="pmid">33739800</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288435">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rozenberg</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Zvereva</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Dalina</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Blatov</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Zubarev</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Luppov</surname>
              <given-names>D.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>The p53 family member p73 in the regulation of cell stress response</article-title>
          <source>Biology Direct</source>
          <year>2021</year>
          <volume>16</volume>
          <issue>1</issue>
          <fpage>23</fpage>
          <issn>1745-6150</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1186/s13062-021-00307-5</pub-id>
          <pub-id pub-id-type="pmid">34749806</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288436">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rosenbluth</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Pietenpol</surname>
              <given-names>J.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>mTOR regulates autophagy-associated genes downstream of p73</article-title>
          <source>Autophagy</source>
          <year>2009</year>
          <volume>5</volume>
          <issue>1</issue>
          <fpage>114</fpage>
          <lpage>6</lpage>
          <issn>1554-8635</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.4161/auto.5.1.7294</pub-id>
          <pub-id pub-id-type="pmid">19001857</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288437">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Abed</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Novin</surname>
              <given-names>M.G.</given-names>
            </name>
            <name>
              <surname>Omrani</surname>
              <given-names>M.D.</given-names>
            </name>
            <name>
              <surname>Bandehpour</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Norozian</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Hosseini</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Evaluation the Effect of Female Age Factor on Human Oocyte Aneuploidy and Its Relation to P73 Gene Expression</article-title>
          <source>Journal of Applied Environmental and Biological Sciences</source>
          <year>2015</year>
          <volume>5</volume>
          <issue>4</issue>
          <fpage>216</fpage>
          <lpage>21</lpage>
          <issn>2090-4274</issn>
        </element-citation>
      </ref>
      <ref id="R254494232288438">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vagnini</surname>
              <given-names>L.D.</given-names>
            </name>
            <name>
              <surname>Renzi</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Oliveira-Pelegrin</surname>
              <given-names>G.R.</given-names>
            </name>
            <name>
              <surname>Canas</surname>
              <given-names>M.C.</given-names>
            </name>
            <name>
              <surname>Petersen</surname>
              <given-names>C.G.</given-names>
            </name>
            <name>
              <surname>Mauri</surname>
              <given-names>A.L.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>The TP73 gene polymorphism (rs4648551, A&gt;G) is associated with diminished ovarian reserve</article-title>
          <source>PLoS One</source>
          <year>2015</year>
          <volume>10</volume>
          <issue>3</issue>
          <fpage>e0120048</fpage>
          <issn>1932-6203</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1371/journal.pone.0120048</pub-id>
          <pub-id pub-id-type="pmid">25794170</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288439">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gónzalez</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Ramírez-Lorca</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Calatayud</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Mendoza</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Ruiz</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Sáez</surname>
              <given-names>M.E.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Association of genetic markers within the BMP15 gene with anovulation and infertility in women with polycystic ovary syndrome</article-title>
          <source>Fertility and Sterility</source>
          <year>2008</year>
          <volume>90</volume>
          <issue>2</issue>
          <fpage>447</fpage>
          <lpage>9</lpage>
          <issn>1556-5653</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.fertnstert.2007.06.083</pub-id>
          <pub-id pub-id-type="pmid">17905236</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288440">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sproul</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Jones</surname>
              <given-names>M.R.</given-names>
            </name>
            <name>
              <surname>Mathur</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Azziz</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Goodarzi</surname>
              <given-names>M.O.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Association study of four key folliculogenesis genes in polycystic ovary syndrome</article-title>
          <source>BJOG</source>
          <year>2010</year>
          <volume>117</volume>
          <issue>6</issue>
          <fpage>756</fpage>
          <lpage>60</lpage>
          <issn>1471-0528</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1111/j.1471-0528.2010.02527.x</pub-id>
          <pub-id pub-id-type="pmid">20236105</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288441">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Santiquet</surname>
              <given-names>N.W.</given-names>
            </name>
            <name>
              <surname>Greene</surname>
              <given-names>A.F.</given-names>
            </name>
            <name>
              <surname>Becker</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Barfield</surname>
              <given-names>J.P.</given-names>
            </name>
            <name>
              <surname>Schoolcraft</surname>
              <given-names>W.B.</given-names>
            </name>
            <name>
              <surname>Krisher</surname>
              <given-names>R.L.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A pre-in vitro maturation medium containing cumulus oocyte complex ligand-receptor signaling molecules maintains meiotic arrest, supports the cumulus oocyte complex and improves oocyte developmental competence</article-title>
          <source>MHR: Basic science of reproductive medicine</source>
          <year>2017</year>
          <volume>23</volume>
          <issue>9</issue>
          <fpage>594</fpage>
          <lpage>606</lpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/molehr/gax032</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288442">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fonseca-Mendoza</surname>
              <given-names>D.J.</given-names>
            </name>
            <name>
              <surname>Ortega-Recalde</surname>
              <given-names>O.</given-names>
            </name>
            <name>
              <surname>Esteban-Perez</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Moreno-Ortiz</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Patiño</surname>
              <given-names>L.C.</given-names>
            </name>
            <name>
              <surname>Bermúdez</surname>
              <given-names>O.M.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>BMP15 c.-9C&gt; G promoter sequence variant may contribute to the cause of non-syndromic premature ovarian failure</article-title>
          <source>Reproductive BioMedicine Online</source>
          <year>2014</year>
          <volume>29</volume>
          <issue>5</issue>
          <fpage>627</fpage>
          <lpage>33</lpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.rbmo.2014.07.01</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288443">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Otsuka</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Inagaki</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Unique bioactivities of bone morphogenetic proteins in regulation of reproductive endocrine functions</article-title>
          <source>Reproductive Medicine and Biology</source>
          <year>2011</year>
          <volume>10</volume>
          <issue>3</issue>
          <fpage>131</fpage>
          <lpage>42</lpage>
          <issn>1445-5781</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s12522-011-0082-9</pub-id>
          <pub-id pub-id-type="pmid">29662354</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288444">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kirkpatrick</surname>
              <given-names>B.W.</given-names>
            </name>
            <name>
              <surname>Morris</surname>
              <given-names>C.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A major gene for bovine ovulation rate</article-title>
          <source>PLoS One</source>
          <year>2015</year>
          <volume>10</volume>
          <issue>6</issue>
          <fpage>e0129025</fpage>
          <issn>1932-6203</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1371/journal.pone.0129025</pub-id>
          <pub-id pub-id-type="pmid">26046917</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288445">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hanevik</surname>
              <given-names>H.I.</given-names>
            </name>
            <name>
              <surname>Hilmarsen</surname>
              <given-names>H.T.</given-names>
            </name>
            <name>
              <surname>Skjelbred</surname>
              <given-names>C.F.</given-names>
            </name>
            <name>
              <surname>Tanbo</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Kahn</surname>
              <given-names>J.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A single nucleotide polymorphism in BMP15 is associated with high response to ovarian stimulation</article-title>
          <source>Reproductive Biomedicine Online</source>
          <year>2011</year>
          <volume>23</volume>
          <issue>1</issue>
          <fpage>97</fpage>
          <lpage>104</lpage>
          <issn>1472-6491</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.rbmo.2011.02.015</pub-id>
          <pub-id pub-id-type="pmid">21565556</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288446">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Galloway</surname>
              <given-names>S.M.</given-names>
            </name>
            <name>
              <surname>McNatty</surname>
              <given-names>K.P.</given-names>
            </name>
            <name>
              <surname>Cambridge</surname>
              <given-names>L.M.</given-names>
            </name>
            <name>
              <surname>Laitinen</surname>
              <given-names>M.P.</given-names>
            </name>
            <name>
              <surname>Juengel</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>Jokiranta</surname>
              <given-names>T.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner</article-title>
          <source>Nature Genetics</source>
          <year>2000</year>
          <volume>25</volume>
          <issue>3</issue>
          <fpage>279</fpage>
          <lpage>83</lpage>
          <issn>1061-4036</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/77033</pub-id>
          <pub-id pub-id-type="pmid">10888873</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288447">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Qin</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Jiao</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Simpson</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Z.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Genetics of primary ovarian insufficiency: new developments and opportunities</article-title>
          <source>Human Reproduction Update</source>
          <year>2015</year>
          <volume>21</volume>
          <issue>6</issue>
          <fpage>787</fpage>
          <lpage>808</lpage>
          <issn>1460-2369</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/humupd/dmv036</pub-id>
          <pub-id pub-id-type="pmid">26243799</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288448">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tiotiu</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Alvaro Mercadal</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Imbert</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Verbist</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Demeestere</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>De Leener</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Variants of the BMP15 gene in a cohort of patients with premature ovarian failure</article-title>
          <source>Human Reproduction (Oxford, England)</source>
          <year>2010</year>
          <volume>25</volume>
          <issue>6</issue>
          <fpage>1581</fpage>
          <lpage>7</lpage>
          <issn>1460-2350</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1093/humrep/deq073</pub-id>
          <pub-id pub-id-type="pmid">20364024</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288449">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhang</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Shi</surname>
              <given-names>Y.H.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>L.C.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Z.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Sequence variants in exons of the BMP-15 gene in Chinese patients with premature ovarian failure</article-title>
          <source>Acta Obstetricia et Gynecologica Scandinavica</source>
          <year>2007</year>
          <volume>86</volume>
          <issue>5</issue>
          <fpage>585</fpage>
          <lpage>9</lpage>
          <issn>0001-6349</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1080/00016340701269492</pub-id>
          <pub-id pub-id-type="pmid">17464588</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288450">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tabibzadeh</surname>
              <given-names>S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Signaling pathways and effectors of aging</article-title>
          <source>Frontiers in Bioscience (Landmark Edition)</source>
          <year>2021</year>
          <volume>26</volume>
          <issue>1</issue>
          <fpage>50</fpage>
          <lpage>96</lpage>
          <issn>2768-6698</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.2741/4889</pub-id>
          <pub-id pub-id-type="pmid">33049665</pub-id>
        </element-citation>
      </ref>
      <ref id="R254494232288451">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kang</surname>
              <given-names>H.J.</given-names>
            </name>
            <name>
              <surname>Rosenwaks</surname>
              <given-names>Z.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>p53 and reproduction</article-title>
          <source>Fertility and Sterility</source>
          <year>2018</year>
          <volume>109</volume>
          <issue>1</issue>
          <fpage>39</fpage>
          <lpage>43</lpage>
          <issn>1556-5653</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.fertnstert.2017.11.026</pub-id>
          <pub-id pub-id-type="pmid">29307398</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
