The sequence of LipL41 was retrieved from UniProt (www.uniprot.org) with the UniProt ID: Q33BM7, comprising 355 residues. A sequence similarity search for the target sequence was conducted using the Protein Data Bank on the BLAST server24. The Modeller software (version 9.9) was utilized to generate the structural model of the LipL41 protein25. Following prediction, the generated structure was saved in PDB format, and scores were calculated based on Discrete Optimized Protein Energy (DOPE)26. Standard programs evaluated the quality of the optimized model27, 28, 29. The final optimized structural model and spiral model were used for further analysis. Three significant glycoproteins or molecular adjuvants (hC3d, GMCSF, and hIgGFC) were employed to evaluate the binding effectiveness of the LipL41 protein. ClusPro 2.0 was used to investigate the potency of LipL41's interactions with molecular adjuvants30.

Construction of pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 Plasmid

The EGFP (Enhanced Green Fluorescent Protein) gene, generously provided by Dr. B. Ashok Kumar from Madurai Kamaraj University, India, was amplified from the pEGFP plasmid. Furthermore, the study utilized the hGMCSF (human Granulocyte-Macrophage Colony-Stimulating Factor) gene, which was graciously provided by Dr. Tracy Willson from The Walter and Eliza Hall Institute of Medical Research, Australia. The transcription of these two genes (EGFP and hGMCSF) was achieved by using pairs of gene-specific primers flanked by a recognition sequence for a restriction enzyme, together with normal PCR conditions. Following electrophoresis on a 0.8% agarose gel, the PCR products underwent purification before being ligated into the pTZ57R/T vector. The resulting ligation mixture was then introduced into E. coli XL10 competent cells. Subsequently, colony PCR was employed to verify the identity of the selected recombinant colonies.

The recombinant DNA was processed using restriction enzyme-bounded primers, and the 1% agarose gel electrophoresis revealed 1056 bp of LipL41, 717 bp of EGFP, and 453 bp of the hGMCSF gene release. The recombinant clones (pTZ-LipL41, pTZ-EGFP, and pTZ-hGMCSF) were sub-cloned into the pTR600 mammalian expression vector (a kind gift from Dr. Ted Ross, University of Pittsburgh, USA), which was constructed to carry the cytomegalovirus (CMV). The recombinant DNA constructs were named pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41. Finally, the recombinant plasmids were extracted using the alkaline lysis method and were purified with a 30 mM concentration of MgCl₂ and different concentrations of polyethylene glycol (PEG) 40% and PEG 6000. Afterwards, the purified plasmids were dissolved using molecular-grade water. Finally, the recombinant plasmids were transfected into the CHO cell line for EGFP expression.

The CHO cell line was cultured in RPMI medium and seeded into cell culture flasks. These flasks were then placed in an incubator set at 37°C with a 5% CO₂ atmosphere for 12 hours. Following incubation, adherent cells were observed using an inverted microscope. Subsequently, the adherent cells were rinsed with 1% trypsin solution and centrifuged at 600 rpm for 5 minutes. The Trypan Blue dye exclusion test determines the number of viable cells in a cell suspension. The cells were counted using a hemocytometer under the light microscope (100X). The following equation determined the number of viable cells: percentage of viable cells (cells/ml) = (average number of cells in 4 quadrants) x dilution factor for the size of the quadrant (i.e., 10,000) x dilution factor for the addition of trypan blue. Finally, 5 x 10⁵ cells per well were added into 6-well plates (35 mm²). The total number of cells within the flask was determined using the following equation: Total cells in the flask = cells/ml x mL.

The recombinant DNA constructs pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 were introduced into the CHO cell line through transfection. The CHO cell lines were cultured in RPMI media, both complete and incomplete, supplemented with 10% FBS and a penicillin-streptomycin antibiotic solution (Hi-Media, India). The cell cultures were maintained at 37°C in a humidified atmosphere with 5% CO₂ concentration.

The CHO cells were cultured by seeding 5 x 10⁵ cells into 6-well plates (35 mm²), and the plates were incubated at 37°C and 5% CO₂ overnight. The CHO cells were transfected with DNA constructs pTR600, pTR-EGFP-LipL41, and pTR-EGFP-hGMCSF-LipL41 using Lipofectamine™ 2000. Briefly, the supernatant 10-15 µL with five µg of plasmid DNA was mixed with RPMI media (Tube A). Tube marked as B has 5μL of Lipofectamine™ 2000 reagent. The contents of tubes A & B were mixed and kept at 37°C for 30 minutes. Subsequently, 1.5 mL of reduced serum media was added to each well, and the master mix (~400μL) was added to each well of 6-well plates (35 mm²). The plates were incubated for 72 hours, performed in triplicate, and repeated twice.

The cytotoxicity assay was employed on pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41. In summary, CHO cells (5 x 10⁵) were subjected to treatment with Lipofectamine 2000 at concentrations of 2.5, 5, 7.5, and 10, and then incubated in the dark for 12 hours. Tests were run in triplicates, and sample sizes (positive and negative controls) were developed. The positive control wells contained Lipofectamine transfect plasmid DNA (pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41), while the negative control wells contained the same number of CHO cells and the pTR600 vector without EGFP. The mixture was incubated for hours at 37°C in a CO₂ incubator with a CO₂ concentration of 5%. The RPMI growth medium was withdrawn after incubation, and 100 mL of growth medium was added with various doses of plasmid DNA pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 (1-10 mg/mL) and maintained for 12 hours at 37°C in a humidified incubator with 5% CO₂. After incubation, the culture media was withdrawn correctly, and 150 μL of MTT was added to each well. MTT cultures were maintained for 3 hours at 37°C in a humidified incubator with a CO₂ concentration of 5%. The proportion of viable cells was calculated using the formula: % viability of cells = (OD of test / OD of control) x 100.

Transfected CHO cells were washed with phosphate-buffered saline (PBS). Washed cells were carefully placed on a glass slide, and the periphery was sealed with nail paint. Mounted slides were observed under the fluorescence microscope. Protein expression (GFP tagged) was checked by fluorescent and confocal microscopy.

The pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 were transfected into the CHO cell line using Lipofectamine™ 2000. The cells that received the genetic material were cultured for 24 hours at a temperature of 37°C in a CO₂ incubator with a CO₂ concentration of 5%. After incubation, RNA isolation was carried out using the Hi-PurA™ Total RNA Miniprep Purification Kit, and cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). A Nanodrop analyzer checked the concentration of cDNA. The 100 ng of cDNA was used to study cytokine and chemokine expression using specific primers. The samples underwent amplification using 20 µL of cDNA, including forward and reverse primers, along with 1X SYBR Green I Master mix (Roche) and molecular-grade water. The PCR cycle consisted of denaturation at 25°C for 10 minutes, annealing at 42°C for 30 minutes, and extension at 85°C for 5 minutes. Details of the RT-PCR primers are provided in Table 1.

Table 1

Cytokines	Forward Primer (5’ – 3’)	Reverse Primer (5’ – 3’)
IL-2	AATTCGGTACATCCTCACGG	GGTTGTTTTCTGCCAGTGCC
IL-6	AATTCGGTACATCCTCGACGG	GGTTGTTTTCTGCCAGTGCC
IL-8	GACCACACTGCGCCAACAC	CTTCTCCACAACCCTCTGCAC
IL-10	GGTTGCCAAGCCTTGTCTGA	AGGGAGTTCACATGCGCCT
TNF α	GGAGAAGGGTGACCGACTCA	CTGCCCAGACTCGGCAA
IFN γ	AGCTCTGCATCGTTTTGGGT	CGCTTCCCTGTTTTAGCTGC
CXCL11	CCTTGGCTGTGATATTGTGTGCTA	CCTATGCAAAGACTGCGTCCTC
CCL17	TGAGGACGCTCCAGGGATG	AACGGTGGACGTCCCAGGTA
β- ACTIN	TCACCCACACTGTGCCCATCTACG	CAGCGGAACCGCTCATTGCCAATG

Table 2

Protein 1	Protein 2	PDB ID of Protein 2	Resolution (Å)	Interaction Energy (Kcal/mol)	Number of Hydrogen Bonds
LipL42 (Theoretical model)	hGMCSF	2GMF_A	2.4	-594.9	246
	hC3D	1C3D_A	1.8	-555.9	198
	MCO	Model	Nil	-428.7	150

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

The intricate configuration was produced by employing ClusPro software to dock LipL41 with three cytokines30. The output generated by ClusPro resulted in the identification of the ten most highly ranked docked structures, which were sorted based on their respective binding energies. The conformation with the least binding energy was selected for further analysis through docking, as indicated in Table 2. The docking outcomes indicate that LipL41 exhibits superior interaction with hGMCSF, as evidenced by the interaction energy of -594.9 Kcal/mol and the formation of 246 hydrogen bonds. The hC3d-LipL41 complex demonstrates an interaction energy of -555.9 Kcal/mol and is distinguished by the creation of 198 hydrogen bonds. In contrast, the hIgGFC-LipL41 complex (MCO) displays an interaction energy of -428.7 Kcal/mol and involves the formation of 150 hydrogen bonds. Upon assessment of the binding energies of the three complexes, it was observed that the GMCSF-LipL41 complex exhibited the lowest binding energy. This finding suggests that the complex in question possesses greater binding efficacy.

The pTZ-LipL41 and pTR-EGFP DNA samples were subjected to restriction digestion using BamHI and XhoI enzymes. The resulting DNA fragments were then examined using 0.8% agarose gel electrophoresis. The digested fragments of pTZ-LipL41 (1065-bp), EGFP (717-bp), and pTR (3.8-kb) were purified by extracting them from the agarose gel, and then a ligation reaction was carried out for the fragments overnight. The ligation mixture was introduced into competent E. coli XL10 cells through transformation, and the resulting transformed colonies were examined for positive clones using colony PCR. The plasmid was extracted from the colony of the positive patch using the alkaline lysis technique, and the clones were verified using restriction digestion analysis with HindIII and XhoI enzymes. The LipL41 and EGFP (1.8-kb) genes were released (Figure 1). The pTR-EGFP-LipL41 plasmids were sequenced and associated with the original LipL41 EGFP sequences. Basic Local Sequence Alignment (BLAST) analysis showed the recombinant clones were 100% identical to the original sequences.

The pTR-EGFP-LipL41 and hGMCSF DNA samples were subjected to restriction digestion using BamHI and XhoI enzymes. The resulting digested DNA fragments were then examined using 0.8% agarose gel electrophoresis. The product resulting from the digestion of pTR-EGFP-LipL41 (1.8-kb) and hGMCSF (453-bp) using restriction enzymes was purified by extracting it from the agarose gel. Subsequently, an overnight ligation reaction was carried out. The ligation mixture was introduced into competent E. coli XL10 cells, and the resulting transformed cells were examined for positive clones by colony PCR. The plasmid was extracted from the colony of the positive patch, and the clones were verified by restriction digestion analysis using NheI and StuI enzymes. A release of EGFP-hGMCSF-LipL41 (2-kb) was observed (Figure 2). The pTR-EGFP-hGMCSF-LipL41 plasmids were sequenced and associated with the original LipL41, EGFP, and hGMCSF sequences. The BLAST analysis showed the recombinant clones were 100% identical to the original sequences.

In this study, we examined the cytotoxic effects of pTR-EGFP-LipL41, pTR-EGFP-hGMCSF-LipL41, and recombinant DNA constructs on the CHO cell line. CHO cells were seeded into 96-well plates and exposed to varying concentrations (ranging from 2.5 to 10 μg/mL) of Lipofectamine. Analysis using the MTT cell viability assay unveiled a dose-dependent trend of cytotoxicity, as illustrated in Figure 3. Additionally, cell viability was assessed. With the 5 μg/mL concentration of Lipofectamine 2000, approximately 90% of cell viability was observed (Figure 3).

The effectiveness of the engineered recombinant DNA complexes in expressing EGFP in the eukaryotic (CHO cell line) system was evaluated by introducing plasmid DNA of pTR600, pTR-EGFP-LipL41, and pTR-EGFP-hGMCSF-LipL41 through transfection. The results were compared with the negative control, pTR600. Fluorescent microscope analysis was conducted 24 and 48 hours after transfection of pTR600, pTR-EGFP-LipL41, and pTR-EGFP-hGMCSF-LipL41 to observe EGFP expression. The results may be seen in Figure 4.

The CHO cells were genetically modified with pTR-EGFP-LipL41 and pTR-EGFP-hGMCSF-LipL41 and then induced with Phorbol 12-myristate 13-acetate (PMA) to produce cytokines and chemokines. Cells were collected following 24 hours of incubation, RNA was isolated, and cDNA was generated using a reverse transcriptase enzyme. An equivalent concentration of the cDNA template was employed to examine the differential cytokine and chemokine production. The cytokines IL-2, IL-6, IL-8, IL-10, IFNγ, TNF-α, and the chemokines CXCL 11 and CCL17 were all subjected to divergent cytokine profiling. Real-time quantitative PCR was conducted utilizing the ABI 7000 Real-Time PCR instrument from Conquer Scientific. β-actin served as an internal control for normalization of the values. The expression of IL-2, IL-6, IL-8, IL-10, IFNγ, CXCL 11, and CCL17 was assessed for both EGFP-LipL41 and EGFP-hGMCSF-LipL41 constructs. Notably, no significant fold change in the expression of TNF-α was observed, as depicted in Figure 5.