The mouse 4T1 cell line (American Type Culture Collection) was thawed and expanded according to the provided guidelines. It was maintained at 37°C in a humidified atmosphere (95%) containing 5% CO₂. It was cultured in growth medium (Roswell Park Memorial Institute [RPMI] 1640 containing 2 mmol/L glutamine [Sigma-Aldrich, Louis St, MO, USA], 10% fetal bovine serum [FBS; Gibco], 1% antibiotic-antimycotic [Sigma-Aldrich]).

The RMPI 1640 medium was supplemented with four glucose concentrations (0, 0.5, 1.0, and 4.5 g/L) and three metformin concentrations (0, 2, and 5 mM). Therefore, this study examined 12 glucose and metformin combinations (G1 to G12; Table 1).

The 4T1 cells were expanded in the standard growth medium and then split into six-well plates at 5,000 cells/well. After 24 h of culturing, the standard growth medium was replaced with the G1–G12 media. The cells were collected for further experiments after 24, 48, and 72 h of culturing in the G1–G12 media. Each medium was used in three wells, and the experiments were performed in triplicate.

The Alamar blue assay was used to assess cell proliferation. The cells were seeded at a density of 5,000 cells/well in 96-well plates. After 24 hours of culturing, the growth medium was discarded and replaced with G1–G12 media. Then, the cells were stained with Alamar blue (Sigma-Aldrich) at a dye:medium ratio of 1:10. After one hour of staining at 37°C with 5% CO₂, each well’s optical density at 595 nm was determined using a DTX880 multimode detector (Beckman Coulter, USA). Data was collected every 24 hours. Triplicates were performed for each group.

The qRT-PCR was performed according to a general protocol. RNA was extracted using the EasyBlue Kit (Thermo Fisher Scientific, USA), and cDNA was synthesized via reverse transcription. The relative mRNA levels were determined using a Luna One-Step RT-qPCR Kit (New England Biolabs). Gene expression was calculated using the 2^−ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the endogenous control. The experiment was performed in triplicate. The following primers were used to amplify the target genes by RT-qPCR: Gapdh forward (GCATCTTCTTGTGCAGTGCC) and reverse (TACGGCCAAATCCGTTCACA), solute carrier family 2 (facilitated glucose transporter), member 1 (Slc2a1/Glut1) forward (ATCGTCGTTGGCATCCTTATT) and reverse (ATCGTCGTTGGCATCCTTATT), Pd-l1 forward (TCCATCCTGTTGTTCCTCATT) and reverse (TCCATCCTGTTGTTCCTCATT), Fas cell surface death receptor (Fas/Cd95) forward (TATCAAGGAGGCCCATTTTGC) and reverse (TGTTTCCACTTCTAAACCATGCT), C-X-C motif chemokine ligand 12 (Cxcl12) forward (TGCATCAGTGACGGTAAACCA) and reverse (CACAGTTTGGAGTGTTGAGGAT), CD276 antigen (Cd276/B7h3) forward (AGCACTGTGGTTCTGCCTCACA) and reverse (CACCAGCTGTTTGGTATCTGTCAG), transforming growth factor beta 1 (Tgfb1) forward (CGGGTCTACTATGCTAAAGAGGTCAC) and reverse (TTTCTCATAGATGGCGTTGTTGC), and SMAD family member 3 (Smad3) forward (GCAGCCGTGGAACTTACAAGGC) and reverse (GGTAGACAGCCTCAAAGCCCTG).

The 4T1 cells were seeded into 24-well plates (SPL, Korea) at 1.5×10⁵ cells/well in RPMI 1640 medium supplemented with 10% FBS and cultured at 37°C with 5% CO₂ for 24 h to form a monolayer. When the cells reached 80% confluence, the middle of the monolayer was scratched with a sterile 100 µL pipette tip and washed with phosphate-buffered saline to clear the scratch. Then, fresh G1–G12 medium was added to each well. After 24 h of culturing, wound closure was evaluated in three randomly selected fields in each well using an inverted microscope (Carl Zeiss Microscopy, LLC). The experiment was performed in triplicate for each group.

The 4T1 cells were imaged at 5× and 10× magnification after treatment with various metformin and glucose concentrations. The 4T1 cells were seeded at a density of 5,000 cells/well in 96-well plates, and images were taken every 24 h for three days. The images were processed with Axio Vision software. All experiments were performed at least three times.

The data were analyzed using GraphPad Prism 8.0 software (GraphPad, USA). Data were compared between groups using Student’s t-test or one-way analysis of variance. The data are presented as mean ± standard deviation (SD). A P < 0.05 was considered statistically significant. All experiments were repeated at least three times.

The 4T1 mouse breast cancer cells showed considerable proliferation when cultured in G1, G4, G7, and G10 media that lacked metformin, particularly at higher (G10) than lower (G4 and G7) glucose concentrations. The 4T1 cells showed lower proliferation in the G2, G3, G5, G6, G8, G9, G11, and G12 media containing metformin than in the G1, G4, G7, and G10 media lacking metformin. In particular, the proliferation of 4T1 cells was significantly decreased in the G2, G3, G5, and G6 media, which combined metformin with low glucose concentrations (Figure 1). These results suggest that metformin inhibits 4T1 cell proliferation at any glucose concentration; the inhibition increased with the metformin concentration.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

The 4T1 mouse breast cancer cells cultured in G1, G4, G7, and G10 media lacking metformin showed strong migration abilities, particularly at higher glucose concentrations. The 4T1 cells showed lower migration when cultured in the G2, G3, G5, G6, G8, G9, and G12 media containing metformin than in the G1, G4, G7, and G10 media lacking metformin. In particular, while 4T1 cells cultured in the G2, G3, and G6 media shed and could not migrate, 4T1 cell migration was significantly decreased when cultured in the G5 medium, which combined metformin with a low glucose concentration. In contrast, 4T1 cells showed better migration when cultured in the G8, G9, G11, and G12 media, which combined high metformin and glucose concentrations. However, these groups migrated less than 4T1 cells cultured in media lacking metformin. These results indicate that metformin inhibits 4T1 cell migration at any glucose concentration; the inhibition increased with the metformin concentration (Figure 2).

Pd-l1 gene expression was similar in 4T1 cells cultured in G1, G4, G7, and G10 media lacking metformin. Interestingly, the media lacking glucose (G1, G2, and G3) but containing metformin did not affect Pd-l1 gene expression in 4T1 cells. However, in 4T1 cells cultured in media containing physiological (G7, G8, and G9) or low (G4, G5, and G6) glucose concentrations, Pd-l1 gene expression tended to increase with the metformin concentration. Interestingly, when considering only the media with the highest glucose concentration (G10, G11, and G12), Pd-l1 gene expression was significantly lower in 4T1 cells cultured in media containing metformin (G11 and G12) than lacking metformin (G10) (Figure 3). These results showed that metformin inhibits Pd-l1 gene expression in 4T1 cells at any glucose concentration; the inhibition increased with the metformin concentration.

Figure 6

Figure 7

Based on the above findings, particularly for Pd-l1 gene expression, a high glucose concentration (4.5 g/L) appeared to impede the immune escape capacity of mouse 4T1 breast cancer cells (Figure 3). Therefore, we investigated the migration of 4T1 cells cultured at a high glucose concentration and treated with various metformin concentrations. When cultured with a high glucose concentration (4.5 g/L), the migration of 4T1 cells decreased significantly with increasing metformin concentration. At 2 and 5 mM metformin, the migration of 4T1 cells was decreased by around 2 (p < 0.01) and 1.5 (p < 0.01) times, respectively, compared to 0 mM metformin (control). In addition, the migration of 4T1 cells differed significantly between 2 and 5 mM metformin, with migration 1.3 times higher with 5 mM metformin than with 2 mM metformin (p < 0.05; Figure 4). In contrast, Tgfb1 gene expression did not change significantly with metformin concentration (p > 0.05; Figure 4). These results indicate that high glucose concentrations influence the immune escape abilities of 4T1 cells via Pd-l1 gene expression and migration. However, they do not indicate that high glucose concentrations influence the expression of the migration-related gene Tgfb1.

We next investigated the effects of a high glucose concentration (4.5 g/L) and various metformin concentrations on mouse 4T1 breast cancer cells using various approaches, including assessing cell density using inverted microscopy, proliferation ability using Alamar blue staining, and the expression of proliferation-related gene Smad3 and metabolism-associated gene Glut1. The cell density assessments showed that 4T1 cells grew normally and without apoptosis (Figure 5), consistent with the earlier findings (Figure 1). In addition, 4T1 cells showed lower proliferation with than without metformin after 24 h. Specifically, 2 and 5 mM metformin decreased the growth of 4T1 cells by 1.58 times (p < 0.05) and 1.64 times (p < 0.05), respectively, compared to 4T1 cells not treated with metformin. However, 4T1 cell proliferation did not differ significantly between 2 and 5 mM metformin (p > 0.05; Figure 5).

Smad3 gene expression was closely associated with the proliferation of 4T1 mouse breast cancer cells, decreasing as the metformin concentration increased (Figure 5C). Smad3 gene expression was significantly lower in 4T1 cells treated with 2 mM (2.86-fold; p < 0.0001) and 5 mM (5.26-fold; p < 0.0001) metformin than in cells not treated with metformin (Figure 5C). In addition, Glut1 gene expression increased with the glucose concentration, although it did not change significantly (p > 0.05; Figure 5D).

The immune escape capacity of mouse 4T1 breast cancer cells was then explored by examining the expression of some associated genes: Cxcl12, B7h3, and Cd95 (Figure 6). The expression of immune escape-related genes decreased significantly with increasing metformin concentration. Cxcl12 gene expression was significantly lower at 2 mM metformin (1.6-fold; p < 0.05) and 5 mM metformin (2.0-fold; p < 0.05) than at 0 mM metformin (Figure 6A). In contrast, Cd95 gene expression was significantly lower at 2 mM metformin than at 0 mM metformin (1.25-fold; p < 0.05) and 5 mM metformin (1.8-fold; p < 0.05; Figure 6C). However, while B7h3 gene expression decreased as the metformin concentration increased, the changes were nonsignificant (p > 0.05; Figure 6B).

Then, we compared the proliferation of mouse 4T1 breast cancer cells cultured with fresh medium every 24 h to those cultured without media exchange over three days. This experiment was conducted to ensure that the daily change of the medium maintained the desired glucose concentration, replacing the glucose used by the cells, which could lead to inaccurate assessments for each glucose concentration (0, 0.5, 1.0, and 4.5 g/L). The growth rate differed significantly between changing the medium daily and not changing the medium. The growth rate was significantly higher with than without daily medium changes at 24 h (p < 0.05), 48 h (p < 0.01), and 72 h (p < 0.01; Figure 7). Therefore, replacing the medium every 24 h ensured a constant glucose concentration that helped stabilize the environment for cancer cells.

Overall, these results showed that a high glucose concentration (4.5 g/L) affected the expression of immune escape-related genes in mouse 4T1 breast cancer cells when combined with different metformin concentrations.