ADSC candidates were confirmed and characterized as ADSCs by the following assays:

To evaluate the effects of glucose on the senescence of ADSCs, ADSCs at the 5^th passage were cultured in 3 different glucose media with: 17.5 mM (M1; ADSCCult I medium), 35 mM (M2; ADSCCult I medium supplemented with glucose to a final concentration of 35 mM), and 55 mM (M3 ADSCCult I medium supplemented with glucose to a final concentration of 55 mM).

ADSCs were seeded on an E-plate 96 (1,000 cells/well) and cultured for 12 h in ADSCCult I medium before replenishment with M1, M2, or M3 medium. After 12 h, the medium was replaced with fresh medium of M1, M2, or M3. The cells were monitored for their proliferation during 72 h without any medium change. Cell index values were recorded every 3 h (up to 72 h) using the Real-Time Cell Analyzer xCELLigence System (Roche-Applied Science, Indianapolis, IN, USA). The doubling time values were calculated based on the proliferation curves.

The senescent status of ADSCs was evaluated basing on the Senescence Assay kit (measures beta-galactosidase; obtained from Abcam, Cambridge, UK). ADSCs cultured in M1, M2, and M3 were treated in those media for 72 h before they were assayed to record the senescent status. After 72 h, cells grown under those 3 glucose conditions were replenished with fresh media supplemented with Senescence dye (at 1.5 $\mu L$ of Senescence dye per 500 $\mu L$ of medium), then incubated for 2 h at 37^oC, 5% CO₂.

After incubation, the cells were washed with washing buffer. Then, the adherent cells were collected by De-attachment Solution. These cells were re-suspended in Facsfluid olution for flow cytometry analysis using the BD FASCalibur machine (BD Biosciences) with CellQuest Pro software. The positive signal was recorded at FL-1 channel for the senescence dye. This assay was performed in triplicate, and the mean values were calculated and compared between groups.

The expression of some genes related to the senescence was evaluated by real-time RT-PCR. ADSCs at the 10^th passage were cultured in the M1, M2 or M3 medium, and after 72h, were collected to isolate total RNA using the Purelink RNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). ADSCs were collected by De-attachment Solution (Regenemedlab). Next, the cell pellet was lysed by Lysis buffer with 2-mercaptoethanol. The lysate was centrifuged at 12,000 g for 2 min, and then the lysate was passed through a 18-20 G syringe for 5-10 times before centrifugation at 26,000 g for 5 min to collect the supernatant. Finally, the supernatant was used to purify the RNA through columns. The purified RNA was assayed in real-time RT-PCR. We performed quantitative PCR with SYBR Green on a LightCycler® 480 system (480 Real-Time PCR System; Roche, Indianapolis, IN, USA).

Table 1

Genes	Forward (5’-3’)	Reverse (5’-3’)
p16 ink4a	CTTCCCCCACTACCGTAAAT	TGCTCACTCCAGAAAACTCC
p21	AAACTTTGGAGTCCCCTCAC	AAAGGCTCAACACTGAGACG
p53	TCTACCTCCCGCCATAAAA	CTCCTCCCCACAACAAAAC
mTOR	CTGGGACTCAAATGTGTGCAGTTC	GAACAATAGGGTGAATGATCCGGG
GAPDH	ACCACAGTCCATGCCATCAC	TCCACCACCCTGTTGCTGTA

The data were analyzed for statistical significance using GraphPad Prism (GraphPad Software, Inc., La Jolla, CA, USA). Data were presented as mean ± SEM. When applicable, Student's unpaired t-test and one-way ANOVA test were used to determine significance; p<0.05 was considered to be statistically significant.

The ADSCs were successfully isolated and expanded as the published results 15. ADSC exhibited fibroblast-like shape. They were positive for common markers of MSCs, including CD44 (98.21%), CD73 (99.1%), and CD90 (100%); they were negative/low for hematopoietic cell markers, such as CD14 (2.67%), CD45 (1.31%), and HLA-DR (3.14%). The cells also passed the in vitro differentiation assays - which showed successful differentiation into adipocytes, osteoblasts, and chondroblasts.

The results of the proliferation curves of ADSCs cultured in M1, M2, and M3 media are presented in Figure 1. The data show that from 0-12 h, the proliferation curve of cells in M1, M2, or M3 media were not significantly different from each other. This meant that in this initial stage, the cells started to adhere to the surface of the E-plates, causing an increase in the electrical resistance. From 12-45 h, the ADSCs in the M1, M2, and M3 media gradually grew in number. There were slight differences in the proliferation rates among M1, M2, and M3. The proliferation rate for M1 was the highest, while the rate for M2 was the lowest.

However, clear difference in proliferation rates were recorded from 45-72 h. ADSCs cultured in M1 grew well such that the proliferation rate showed a continuous gain. However, the proliferation rates of ADSCs in M2, as well as M3, showed a decrease, starting at the 45 h time point. Although there was no significant difference between the cell proliferation rate of M2 versus that of M3, it seemed that the proliferation rate of ADSCs in M3 showed a stronger decline (p>0.05).

Figure 1

To evaluate the effects of glucose on cell proliferation, we analyzed cell doubling time. The results showed that when ADSCs were cultured in M1, the cell doubling time was 2.13±0.15 h and 2.4±0.1 h for the 5^th and 10^th passages, respectively. However, these values significantly increased to 3.43±0.31 and 4.03±0.57 for the 5^th and 10^th passages, respectively, for ADSCs cultured in M2. The values were 3.4±0.3 h and 4.5± 0.15 h for the 5^th and 10^th passages, respectively, for ADSCs cultured in M3 (Figure 2).

Figure 2

The senescence of ADSCs was evaluated by flow cytometry after culture in M1, M2, or M3 medium (Figure 3). There were significant differences in the senescence dye-positive cells among M1, M2, and M3, for both the 5^th and 10^th passage of ADSCs. In general, for the 10^th passage of ADSCs, the percentage of positive cells was higher than that of the 5^th passage ADSCs, in all media (M1, M2, and M3).

In the higher glucose concentration medium, the percentage of positive cells was also higher than in the lower glucose concentration medium. As in Figure 3, at the 5^th passage of ADSCs, the rate of positive cells increased from 2±1% in M1 to 9.33±3.05% in M2 and 38.33±7.64% in M3 (p<0.05). At the 10^th passage of ADSCs, the percentages were 7±2% in M1, 26.67±5.77% in M2, and 60±10% in M3 (p<0.05).

Figure 3

The expression of p16, p21, p53 and mTOR was evaluated in ADSCs (at the 10^th passage) after culture in M1, M2, and M3 medium. Gene expression level was normalized to GAPDH (set as 100%). The results showed that all investigated genes, including p16, p21, p53 and mTOR, was strongly expressed when ADSCs were cultured in M2 and M3 (p<0.05). The data also show that there was a significantly difference in the expression level of these genes when ADSCs were cultured in M1, as compared to M2 or M3 (p<0.05) (Figure 4).

The expression levels of these genes were also different for ADSCs cultured in M2 versus M3 (p<0.05). However, only two genes (p16 and mTOR) were increased in M3 compared to M2. Although the expression levels of p21 and p53 were higher in M3 versus M2, the differences were non-significant (p>0.05) (Figure 4).

Figure 4

Stem cell therapy, including ADSC transplantation, is now considered as one of the most promising therapies for some degenerative diseases. Indeed, MSCs in general, as well as ADSCs specifically, can exert therapeutic effects via at least three mechanisms: 1) homing and differentiation to the specialized cells, 2) immune modulation, and 3) production of cytokines and growth factors (that can affect the healing). In light of these functions, the in vitro expansion of ADSCs has become a major interest of study in order to optimize the long-term production of adequate numbers of stem cells for use in clinical applications. However, the natural senescence of ADSCs after the long-term in vitro expansion has been the most difficult part of ADSC production for application. Our preliminary study herein has demonstrated that glucose can be a predominant factor which trigger premature senescence of ADSCs.

Glucose is an essential source of energy for cells as well as stem cells. This energy serves in protein and lipid synthesis. When glucose is available in culture medium, it enters the stem cells through glucose transporter facilitators (GLUT) and glucose transporters. However, high concentration of glucose can cause toxicity of cells. In some previous studies, high glucose concentration was shown to impair β-cell function and subsequently induce apoptosis16, affect pancreatic β-cells, lead to oxidative damage in the body (such as eyes, kidneys, nerves, and blood vessels)17, and induce cellular senescence18,19.

In this study, we provide more evidence on the effects of high glucose concentration in inducing senescence. Our results confirmed that at high glucose concentration (35 mM or 55 mM), ADSCs proceeded to the senescent phase. Indeed, at the 5^th and 10^th passages, ADSCs cultured in the high glucose concentration media displayed characteristics of senescent cells.

Firstly, the proliferation rates of the ADSCs grown under the high concentrations were clearly decreased. Reduction of proliferation rate was measured through cell proliferation curves and doubling time. Unlike ADSCs cultured in lower glucose concentration (17.5 mM), ADSCs cultured in high concentrations (35 mM and 55 mM) rapidly underwent the aging phase after 45 hours of culture, while ADSCs cultured in 17.5 mM glucose continued to proliferate out to 72 hours. Moreover, the doubling time of ADSCs in the higher glucose concentrations was also more extended.

Secondly, the beta-galactosidase assay confirmed the above observations. Beta-galactosidase is an enzyme that catalyzes the hydrolysis of beta-galactosides into monosaccharides through the breaking of the glycosidic bond. The expression of beta-galactosidase is associated with senescence and, thus, is used as a biomarker for cellular senescence 20,21.

In 1995, the study by Dimri et al. (1995) showed that only cells in senescence state stained positive for beta-galactosidase. Since then, the beta-galactosidase assay has been used as an important test for determining senescence22,23,24. The results of study herein showed that the percentage of cells positive for beta-galactosidase staining was significantly increased when ADSCs were cultured in higher glucose concentrations (35 mM and 55 mM), as compared to ADSCs cultured in lower (17.5 mM) glucose concentration. More interestingly, at 55 mM glucose concentration, the percentage of positive cells was recorded to be higher than at 35 mM. These observations suggest that high glucose (particularly 55 mM) can trigger cellular senescence in ADSCs.

Some published studies have also showed that reducing glucose can stimulate cell proliferation, and that high glucose can enhance apoptosis in a rat model 18. Other studies have also found that beta-cell mass is reduced in diabetic patients and apoptosis is increased25,26,27. Stolzing et al. evaluated the effects of high glucose on the senescence of bone marrow MSCs; they also showed that high glucose medium had an adverse impact on colony formation and differentiation of these cells 28. In the primary evaluation of glucose on ADSCs, Liang et al. showed that low glucose is a positive factor that affects the survival and biological behaviors of ADSC29. In accordance with Liang et al., Elseberg et al. also showed data to suggest that the concentration of glucose in cell culture medium can affect MSC proliferation30.

In the subsequent assay, we attempted to determine the mechanisms of aging in ADSCs cultured in high glucose-containing medium. Gene expression was evaluated for several genes related to aging, and the analysis showed that there were significant increases of some genes, such as p16, p21, p53 and mTOR. These results suggested that glucose can induce or trigger the expression of these genes. However, upon further analysis after increasing the glucose concentration to 50 mM, we did not find continual increase expression of p21 or p53, but only increased expression of p16 and mTOR. These preliminary observations suggest that the expression of the 2 genes, p16 and mTOR, may depend on the glucose concentration in the culture medium. This observation is similar to findings from a previous publication which suggested that mTOR is associated with stem cell aging12,31,32,33; in that study by Zhang et al. (2017), the authors showed that high glucose concentration can induce the expression of mTOR that cause the senescence of bone marrow MSCs in a rat model12.

In other studies, other mechanisms of senescence induced by high glucose concentration were detected. For example, Kim et al. showed miR-486-5p up-regulation in ADSCs cultured in high glucose-containing medium34.

In vitro expansion of ADSCs is an essential step to harvest enough stem cells for in vitro assays and also clinical application. However, a major obstacle in stem cell manufacturing is stem cell aging after long-term expansion. This study showed that glucose concentrations in culture medium can affect senescence of ADSCs. At high concentrations (35 mM or 55 mM), glucose can trigger the expression of p16, p21, p53 and mTOR (particularly of p16 and mTOR), which can promote the early senescent phenotype in ADSCs.

Our study results suggest that fewer ADSCs may undergo senescence from the use of low glucose concentration in culture medium. Thus, ADSCs should be cultured in low glucose culture medium, or normal glucose concentration, to optimize their proliferation in vitro as well as in vivo. Moreover, further investigation of suitable glucose concentration for ADSC expansion will be essential for understanding and exploring optimal ADSC expansion for clinical applications.

ADSC: Adipose derived stem cell

h: hour

MSC: Mesenchymal stem cell

Authors declare no conflict of interest.

LHP performed the AT-MSCs preparation: isolation and expansion, draft the manuscript; performed the in vitro differentiation and characterization; PVP collected data, analysed the data; performed the senescence assays. All authors read and approved the final manuscript for publication.

This research was funded by Fostering Innovation through Research, Science and Technology, Viet Nam via project 15/FIRST/2a/SCI.

Wang M. Yuan Q. Xie L. Mesenchymal stem cell-based immunomodulation: properties and clinical application Stem cells international 2018 2018 10.1155/2018/3057624 Antoniou K.M. Karagiannis K. Tsitoura E. Bibaki E. Lasithiotaki I. Proklou A. Clinical applications of mesenchymal stem cells in chronic lung diseases Biomed Rep 2018 8 4 314 8 2049-9434 10.3892/br.2018.1067 29556380 McCarthy M.E. Brown T.A. Bukowska J. Bunnell B.A. Frazier T. Wu X. Therapeutic Applications for Adipose-Derived Stem Cells in Wound Healing and Tissue Engineering Curr Stem Cell Rep 2018 4 2 127 37 2198-7866 10.1007/s40778-018-0125-9 Sukho P. Cohen A. Hesselink J.W. Kirpensteijn J. Verseijden F. Bastiaansen-Jenniskens Y.M. Adipose tissue-derived stem cell sheet application for tissue healing in vivo: a systematic review Tissue Eng Part B Rev 2018 24 1 37 52 1937-3368 10.1089/ten.teb.2017.0142 28665192 Kastrup J. Haack-S∅rensen M. Juhl M. Harary S∅ndergaard R. Follin B. Drozd Lund L. Cryopreserved Off-the-Shelf Allogeneic Adipose-Derived Stromal Cells for Therapy in Patients with Ischemic Heart Disease and Heart Failure-A Safety Study Stem Cells Transl Med 2017 6 11 1963 71 2157-6564 10.1002/sctm.17-0040 28880460 Scott L.J. Darvadstrocel: A Review in Treatment-Refractory Complex Perianal Fistulas in Crohn's Disease BioDrugs 2018 32 6 627 34 1173-8804 10.1007/s40259-018-0311-4 30298387 Gu Y. Li T. Ding Y. Sun L. Tu T. Zhu W. Changes in mesenchymal stem cells following long-term culture in vitro Mol Med Rep 2016 13 6 5207 15 1791-2997 10.3892/mmr.2016.5169 27108540 Jiang T. Xu G. Wang Q. Yang L. Zheng L. Zhao J. In vitro expansion impaired the stemness of early passage mesenchymal stem cells for treatment of cartilage defects Cell Death Dis 2017 8 6 e2851 2041-4889 10.1038/cddis.2017.215 28569773 Yang Y.K. Ogando C.R. Wang See C. Chang T.Y. Barabino G.A. Changes in phenotype and differentiation potential of human mesenchymal stem cells aging in vitro Stem Cell Res Ther 2018 9 1 131 1757-6512 10.1186/s13287-018-0876-3 29751774 Truong N.C. Bui K.H. Pham P. Van Characterization of Senescence of Human Adipose-Derived Stem Cells After Long-Term Expansion Adv Exp Med Biol 2018 0065-2598 10.1007/5584_2018_235 30242785 Safwani W.K. Makpol S. Sathapan S. Chua K.H. The impact of long-term in vitro expansion on the senescence-associated markers of human adipose-derived stem cells Appl Biochem Biotechnol 2012 166 8 2101 13 0273-2289 10.1007/s12010-012-9637-4 22391697 Zhang D. Lu H. Chen Z. Wang Y. Lin J. Xu S. High glucose induces the aging of mesenchymal stem cells via Akt/mTOR signaling Mol Med Rep 2017 16 2 1685 90 1791-2997 10.3892/mmr.2017.6832 28656269 Chang T.C. Hsu M.F. Wu K.K. High glucose induces bone marrow-derived mesenchymal stem cell senescence by upregulating autophagy PLoS One 2015 10 5 e0126537 1932-6203 10.1371/journal.pone.0126537 25961745 Phuc P. Ngoc V. Nhan P. Dung L. Nhat T. Nhung T. Good manufacturing practice-compliant isolation and culture of human adipose-derived stem cells Biomed Res Ther 2016 1 04 133 41 2198-4093 Pham L.H. Vu N.B. Van Pham P. The subpopulation of CD105 negative mesenchymal stem cells show strong immunomodulation capacity compared to CD105 positive mesenchymal stem cells Biomed Res Ther 2019 6 4 3131 40 2198-4093 10.15419/bmrat.v6i4.538 Liu J. Wu Y. Wang B. Yuan X. Fang B. High levels of glucose induced the caspase-3/PARP signaling pathway, leading to apoptosis in human periodontal ligament fibroblasts Cell Biochem Biophys 2013 66 2 229 37 1085-9195 10.1007/s12013-012-9470-y 23161104 Robertson R.P. Harmon J.S. Diabetes, glucose toxicity, and oxidative stress: A case of double jeopardy for the pancreatic islet β cell Free Radic Biol Med 2006 41 2 177 84 0891-5849 10.1016/j.freeradbiomed.2005.04.030 16814095 Stolzing A. Coleman N. Scutt A. Glucose-induced replicative senescence in mesenchymal stem cells Rejuvenation Res 2006 9 1 31 5 1549-1684 10.1089/rej.2006.9.31 16608393 Chang J. Li Y. Huang Y. Lam K.S. Hoo R.L. Wong W.T. Adiponectin prevents diabetic premature senescence of endothelial progenitor cells and promotes endothelial repair by suppressing the p38 MAP kinase/p16INK4A signaling pathway Diabetes 2010 59 11 2949 59 0012-1797 10.2337/db10-0582 20802255 Hall B.M. Balan V. Gleiberman A.S. Strom E. Krasnov P. Virtuoso L.P. Aging of mice is associated with p16(Ink4a)- and β-galactosidase-positive macrophage accumulation that can be induced in young mice by senescent cells Aging (Albany NY) 2016 8 7 1294 315 1945-4589 10.18632/aging.100991 27391570 Hall B.M. Balan V. Gleiberman A.S. Strom E. Krasnov P. Virtuoso L.P. p16(Ink4a) and senescence-associated β-galactosidase can be induced in macrophages as part of a reversible response to physiological stimuli Aging (Albany NY) 2017 9 8 1867 84 1945-4589 10.18632/aging.101268 28768895 Bassaneze V. Miyakawa A.A. Krieger J.E. A quantitative chemiluminescent method for studying replicative and stress-induced premature senescence in cell cultures Anal Biochem 2008 372 2 198 203 0003-2697 10.1016/j.ab.2007.08.016 17920029 Gary R.K. Kindell S.M. Quantitative assay of senescence-associated β-galactosidase activity in mammalian cell extracts Anal Biochem 2005 343 2 329 34 0003-2697 10.1016/j.ab.2005.06.003 16004951 Itahana K. Campisi J. Dimri G.P. Methods to detect biomarkers of cellular senescence Biological Aging Springer 2007 21 31 Butler A.E. Janson J. Bonner-Weir S. Ritzel R. Rizza R.A. Butler P.C. β-cell deficit and increased β-cell apoptosis in humans with type 2 diabetes Diabetes 2003 52 1 102 10 0012-1797 10.2337/diabetes.52.1.102 12502499 Cho J.H. Lee I.K. Yoon K.H. Ko S.H. Suh S.H. Lee J.M. Selective beta-Cell Loss and alpha-Cell Expansion in Islets of Type 2 Diabetic Patients The Journal of Korean Diabetes Association. 2001 25 2 164 77 Sakuraba H. Mizukami H. Yagihashi N. Wada R. Hanyu C. Yagihashi S. Reduced beta-cell mass and expression of oxidative stress-related DNA damage in the islet of Japanese Type II diabetic patients Diabetologia 2002 45 1 85 96 0012-186X 10.1007/s125-002-8248-z 11845227 Stolzing A. Bauer E. Scutt A. Suspension cultures of bone-marrow-derived mesenchymal stem cells: effects of donor age and glucose level Stem Cells Dev 2012 21 14 2718 23 1547-3287 10.1089/scd.2011.0406 22462498 Liang C. Li H. Tao Y. Zhou X. Li F. Chen G. Responses of human adipose-derived mesenchymal stem cells to chemical microenvironment of the intervertebral disc J Transl Med 2012 10 1 49 1479-5876 10.1186/1479-5876-10-49 22424131 Elseberg C.L. Leber J. Salzig D. Wallrapp C. Kassem M. Kraume M. Microcarrier-based expansion process for hMSCs with high vitality and undifferentiated characteristics Int J Artif Organs 2012 35 2 93 107 0391-3988 10.5301/ijao.5000077 22388939 Liu S. Liu S. Wang X. Zhou J. Cao Y. Wang F. The PI3K-Akt pathway inhibits senescence and promotes self-renewal of human skin-derived precursors in vitro Aging Cell 2011 10 4 661 74 1474-9718 10.1111/j.1474-9726.2011.00704.x 21418510 Iglesias-Bartolome R. Patel V. Cotrim A. Leelahavanichkul K. Molinolo A.A. Mitchell J.B. mTOR inhibition prevents epithelial stem cell senescence and protects from radiation-induced mucositis Cell Stem Cell 2012 11 3 401 14 1934-5909 10.1016/j.stem.2012.06.007 22958932 Zhang D. Yan B. Yu S. Zhang C. Wang B. Wang Y. Coenzyme Q10 inhibits the aging of mesenchymal stem cells induced by D-galactose through Akt/mTOR signaling Oxidative medicine and cellular longevity 2015 2015 Kim Y.J. Hwang S.H. Lee S.Y. Shin K.K. Cho H.H. Bae Y.C. miR-486-5p induces replicative senescence of human adipose tissue-derived mesenchymal stem cells and its expression is controlled by high glucose Stem Cells Dev 2012 21 10 1749 60 1547-3287 10.1089/scd.2011.0429 21988232